BBa_I746916 1 BBa_I746916 superfolder GFP coding sequence 2008-09-29T11:00:00Z 2015-08-31T04:08:05Z Superfolder GFP was originally described by: Pedelacq et al (2006): "Engineering and characterization of a superfolder green fluorescent protein", Nature Biotech 24 (1) January 2006 This version was synthesised de novo (by Geneart). This is the coding sequence of superfolder GFP (Pedelacq et al (2006): "Engineering and characterization of a superfolder green fluorescent protein", Nature Biotech 24 (1) January 2006). It carries the following amino acid changes with respect to mut3 GFP (E0040), the currently most commonly used GFP in the registry: S30R, Y39N, F64L, G65T, F99S, N105T, Y145F, M153T, V163A, I171V, A206V Its in-vivo properties are considerably improved with respect to mut3 - it develops fluorescence about 3fold faster than mut3 GFP and reaches 4fold higher absolute fluorescence levels. Fluorescenct colonies can be identified with the naked eye even without UV or blue light illumination (that is to say the amount of blue light in normal daylight or lablight is sufficient). Additionally it is more stable in vitro and refolds faster after in vitro denaturation with respect to mut3 GFP. Note: Superfolder GFP is available in constructs driven by the pBAD and T7 promoters: part numbers I746908 and I746909 respectively. Additionally 6-his tagged versions for protein purification exist: I746914 (pBAD driven) and I746915 (T7 driven). false false _116_ 0 2122 9 It's complicated false Codon optimisation before de novo synthesis was carried out for both, E.coli and Bacillus subtilis. false Stefan Milde annotation1977535 1 stop range1977535 1 715 720 annotation1977534 1 superfolder GFP coding region range1977534 1 1 720 annotation1977533 1 start range1977533 1 1 3 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_I746909 1 BBa_I746909 superfolder GFP driven by T7 promoter 2008-09-29T11:00:00Z 2015-08-31T04:08:05Z This part was created by standard assembly from construction intermediates: I746911 was put together with I746916:B0015 Released HQ 2013 This is one of the constructs used to characterise superfolder GFP (see I746916 part description for source and other information about this GFP variant) false false _116_ 0 2122 9 In stock false no special considerations true Stefan Milde component1977593 1 BBa_I719005 component1977602 1 BBa_B0012 component1977599 1 BBa_I746916 component1977595 1 BBa_B0034 component1977600 1 BBa_B0010 annotation1977595 1 BBa_B0034 range1977595 1 32 43 annotation1977600 1 BBa_B0010 range1977600 1 778 857 annotation1977602 1 BBa_B0012 range1977602 1 866 906 annotation1977593 1 BBa_I719005 range1977593 1 1 23 annotation1977599 1 BBa_I746916 range1977599 1 50 769 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_I746916_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I746909_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z