BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_I746911 1 BBa_I746911 construction intermediate: T7 promoter - RBS 2008-09-29T11:00:00Z 2015-08-31T04:08:05Z The part was created by standard assembly with parts of the 2007 (B0034) and 2008 (I719005) part distributions This is a construction intermediate: T7 promoter - B0034 RBS It is used to put genes under control of the T7 promoter. false true _116_ 0 2122 9 In stock false no special considerations false Stefan Milde component1977545 1 BBa_I719005 component1977547 1 BBa_B0034 annotation1977547 1 BBa_B0034 range1977547 1 32 43 annotation1977545 1 BBa_I719005 range1977545 1 1 23 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_I746911_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z