BBa_I746916 1 BBa_I746916 superfolder GFP coding sequence 2008-09-29T11:00:00Z 2015-08-31T04:08:05Z Superfolder GFP was originally described by: Pedelacq et al (2006): "Engineering and characterization of a superfolder green fluorescent protein", Nature Biotech 24 (1) January 2006 This version was synthesised de novo (by Geneart). This is the coding sequence of superfolder GFP (Pedelacq et al (2006): "Engineering and characterization of a superfolder green fluorescent protein", Nature Biotech 24 (1) January 2006). It carries the following amino acid changes with respect to mut3 GFP (E0040), the currently most commonly used GFP in the registry: S30R, Y39N, F64L, G65T, F99S, N105T, Y145F, M153T, V163A, I171V, A206V Its in-vivo properties are considerably improved with respect to mut3 - it develops fluorescence about 3fold faster than mut3 GFP and reaches 4fold higher absolute fluorescence levels. Fluorescenct colonies can be identified with the naked eye even without UV or blue light illumination (that is to say the amount of blue light in normal daylight or lablight is sufficient). Additionally it is more stable in vitro and refolds faster after in vitro denaturation with respect to mut3 GFP. Note: Superfolder GFP is available in constructs driven by the pBAD and T7 promoters: part numbers I746908 and I746909 respectively. Additionally 6-his tagged versions for protein purification exist: I746914 (pBAD driven) and I746915 (T7 driven). false false _116_ 0 2122 9 It's complicated false Codon optimisation before de novo synthesis was carried out for both, E.coli and Bacillus subtilis. false Stefan Milde annotation1977535 1 stop range1977535 1 715 720 annotation1977534 1 superfolder GFP coding region range1977534 1 1 720 annotation1977533 1 start range1977533 1 1 3 BBa_I746916_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z