BBa_I748001 1 BBa_I748001 Putative Cyanide Nitrilase Promoter 2007-10-25T11:00:00Z 2015-08-31T04:08:05Z This section of DNA comes from the Pseudomonas fluorescens PfO-1 genome (NC_007492). The GeneID for the nitrilase gene that we working with is 3715134, and the protein ID for the nitrilase gene is YP_349417.1. We took the region 300 base pairs upstream of the nitrilase gene and 10 base pairs downstream into the gene. This section of DNA contains the sequence from 300 base pairs upstream of the Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase gene to 30 base pairs downstream into the gene from Pseudomonas fluorescens PfO-1. Our hope is that this region of DNA will contain the promoter for the nitrilase gene. At the time that this part was submitted, it was not tested or sequenced yet. false false _149_ 0 1654 9 It's complicated false We isolated this segment of DNA from the Pseudomonas fluorescens PfO-1 genome using a PCR reaction. false Kurt Whittemore BBa_I748001_sequence 1 gttgcgcaacgtggtgaatcccaggtccagcggggccaacaggtgcgggtattgagtggcggtcatcgttaactccacagcgagcgatcacggaaaatgcgggagctctgcgtcccccgtcagtcatgctcgacagattaggagtcgcctcgctgtcactcaatgaccgtaactgacaagttattgatccaaatgcgcagcgccccttggcaagccagggctggcgccctaccctgtccgcacaccctgtacccggttgctgttggatttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z