BBa_I749001 1 BBa_I749001 bchB forward primer 2007-10-25T11:00:00Z 2015-08-31T04:08:05Z pHM6 bch B forward primer for the subunit of the light independant protochlorophyllide reductase. false false _109_ 0 969 73 Not in stock false BamHI cut site false Laina Magaya BBa_I749001_sequence 1 ttaagaattcaagaaggagatatacatatgggcggaagcggggtggctgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z