BBa_I750014 1 BBa_I750014 RBS + ComAalt + ter 2007-10-20T11:00:00Z 2015-08-31T04:08:05Z Assembled from registry parts this part can be placed behind your favourite promoter to express ComA false false _132_ 0 1683 9 It's complicated false false Patricia Illing component1951614 1 BBa_B0034 component1951615 1 BBa_I750013 component1951618 1 BBa_B0012 component1951616 1 BBa_B0010 annotation1951616 1 BBa_B0010 range1951616 1 675 754 annotation1951615 1 BBa_I750013 range1951615 1 19 666 annotation1951614 1 BBa_B0034 range1951614 1 1 12 annotation1951618 1 BBa_B0012 range1951618 1 763 803 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_I750013 1 BBa_I750013 ComAalt 2007-10-20T11:00:00Z 2015-08-31T04:08:05Z Synthesized based on genomic sequence in B. subtilus Released HQ 2013 This protein is part of a two part signaling system. Phosphorylation of ComA by ComP(a cell surface receptor) results in its activation. It then initiates transcription from a specific response promoter. This protein is not endogenous to E. coli. false false _132_ 0 1683 9 In stock false true Patricia Illing BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_I750013_sequence 1 atgaaaaaaatcctggtgatcgatgatcatccggcggtgatggaaggcaccaaaaccattctggaaaccgatagcaacctgagcgtggattgcctgagcccggaaccgagcgaacagtttatcaaacagcacgatttcagcagctatgatctgattctgatggatctgaacctgggcggcgaagtgaacggcatggaactgagcaaacaaattctgcaagaaaatccgcattgcaaaatcattgtgtacaccggctatgaagtggaagattacttcgaagaagcgattcgcgcgggtctgcatggcgcgattagcaaaaccgaaagcaaagaaaaaatcacccagtacatctatcatgtgctgaacggcgaaattctggtggatttcgcgtattttaaacagctgatgacccagcagaaaaccaaaccagcgccgagcagccagaaagaacaggatgtgctgaccccgcgtgaatgcctgatcctgcaagaagtggaaaaaggctttaccaaccaagaaattgcggatgcgctgcatctgagcaaacgtagcattgaatatagcctgaccagcatctttaacaaactgaacgtgggcagccgtaccgaagcggtgctgattgcgaaaagcgatggcgtgctgtaataa BBa_I750014_sequence 1 aaagaggagaaatactagatgaaaaaaatcctggtgatcgatgatcatccggcggtgatggaaggcaccaaaaccattctggaaaccgatagcaacctgagcgtggattgcctgagcccggaaccgagcgaacagtttatcaaacagcacgatttcagcagctatgatctgattctgatggatctgaacctgggcggcgaagtgaacggcatggaactgagcaaacaaattctgcaagaaaatccgcattgcaaaatcattgtgtacaccggctatgaagtggaagattacttcgaagaagcgattcgcgcgggtctgcatggcgcgattagcaaaaccgaaagcaaagaaaaaatcacccagtacatctatcatgtgctgaacggcgaaattctggtggatttcgcgtattttaaacagctgatgacccagcagaaaaccaaaccagcgccgagcagccagaaagaacaggatgtgctgaccccgcgtgaatgcctgatcctgcaagaagtggaaaaaggctttaccaaccaagaaattgcggatgcgctgcatctgagcaaacgtagcattgaatatagcctgaccagcatctttaacaaactgaacgtgggcagccgtaccgaagcggtgctgattgcgaaaagcgatggcgtgctgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z