BBa_I752000 1 BBa_I752000 Riboswitch(theophylline) 2007-08-26T11:00:00Z 2015-08-31T04:08:06Z The part was publish by Topp and Gallivan (J. Am. Chem. Soc. 129, p 6865-6873) The riboswitch changes conformation depending on the presence of theophylline. In the absence of theophylline, the switch prevents the binding of the mRNA to the ribosome whilst in the presence of said chemical, the conformation changes and the mRNA behind the switch can then be expressed. false true _129_ 0 1631 9 It's complicated false After sequence information was acquired for the switch from Topp and Gallivan (J. Am. Chem. Soc. 129, p 6865-6873), part was created with required prefix and suffix sequences by gene synthesis (by company XX) true David Franz annotation1944567 1 Riboswitch range1944567 1 1 56 BBa_I752000_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z