BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_I752003 1 BBa_I752003 full RS+CheZ 2007-09-24T11:00:00Z 2015-08-31T04:08:06Z The switch was published by Topp and Gallivan CheZ encoding regulation by theophyline riboswithc with stop codons false false _129_ 0 1631 9 Not in stock false blank false David Franz component1944647 1 BBa_I752000 component1944650 1 BBa_B0010 component1944645 1 BBa_J23119 component1944652 1 BBa_B0012 component1944649 1 BBa_I752001 annotation1944649 1 BBa_I752001 range1944649 1 106 744 annotation1944647 1 BBa_I752000 range1944647 1 44 99 annotation1944650 1 BBa_B0010 range1944650 1 753 832 annotation1944652 1 BBa_B0012 range1944652 1 841 881 annotation1944645 1 BBa_J23119 range1944645 1 1 35 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_I752001 1 BBa_I752001 CheZ coding sequence (Chemotaxis protein) 2007-08-26T11:00:00Z 2016-10-08T03:28:13Z blah CheZ is one of the 6 Che proteins used in chemeotaxis. CheZ is a phosphatase which dephosphorylates CheY which in turn then allows the cell to run and tumble, wheres if CheZ is absence, CheY is phosphorylated, and the cell tumbles exclusively. (Topp and Gallivan J. Am. Chem. Soc. 129, p6865-6873) false false _129_ 25212 1631 9 It's complicated false blah false David Franz annotation1944568 1 CheZ range1944568 1 1 639 BBa_I752000 1 BBa_I752000 Riboswitch(theophylline) 2007-08-26T11:00:00Z 2015-08-31T04:08:06Z The part was publish by Topp and Gallivan (J. Am. Chem. Soc. 129, p 6865-6873) The riboswitch changes conformation depending on the presence of theophylline. In the absence of theophylline, the switch prevents the binding of the mRNA to the ribosome whilst in the presence of said chemical, the conformation changes and the mRNA behind the switch can then be expressed. false true _129_ 0 1631 9 It's complicated false After sequence information was acquired for the switch from Topp and Gallivan (J. Am. Chem. Soc. 129, p 6865-6873), part was created with required prefix and suffix sequences by gene synthesis (by company XX) true David Franz annotation1944567 1 Riboswitch range1944567 1 1 56 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I752000_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag BBa_I752001_sequence 1 atgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctgccagatgtacccgcgcataccagctttactaacgggcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattt BBa_I752003_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaagtactagatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctgccagatgtacccgcgcataccagctttactaacgggcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z