BBa_I756011 1 BBa_I756011 VP16AD+Xba1 2007-08-15T11:00:00Z 2015-08-31T04:08:06Z pACT plasmid VP16 activation domain with Xba1 site at 5' end false false _108_ 0 2113 9 Not in stock false woooooooooooooooot false Omar Khan BBa_I756011_sequence 1 tcgacggcccccccgaccgatgtcagcctgggggacgagctccacttagacggcgaggacgtggcgatggcgcatgccgacgcgctagacgatttcgatctggacatgttgggggacggggattccccgggtccgggatctaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z