BBa_I756014 1 BBa_I756014 LexAoperator-MajorLatePromoter 2007-08-15T11:00:00Z 2015-08-31T04:08:06Z genbank This part contains the LexAoperator and MajorLatePromoter genes with restriction site KdeI at the 5 prime end and AscI at the 3' end. Will use it as both a regulatory part for certain signals as well as a promoter. false false _108_ 0 2071 9 Not in stock false Had to make sure the restriction sites used were not in the sequence or in the sequence of any of the genes downstream of the promoter. false Johannes Hugo Decker BBa_I756014_sequence 1 gagacatatgtcgactgctgtatataaaaccagtggttatatgtacagtactgctgtatataaaaccagtggttatatgtacagtacgtcgactgctgtatataaaaccagtggttatatgtacagtactgctgtatataaaaccagtggttatatgtacagtacgcgtgaccgggtgttcctgaaggggggctataaaagggggtgggggcgcgttggcgcgccacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z