BBa_I757013 1 His His affinity tag 2007-10-23T11:00:00Z 2015-08-31T04:08:07Z synthetic DNA by GeneArt * His-tag * NgoMIV / AgeI protein fusion part * iGEM Team Freiburg 2007 false false _125_ 0 2006 9 Not in stock false between BioBrick 1.0 sites part is flanked 5' by NgoMIV and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions false Freiburg iGEM 2007 team annotation1954507 1 AgeI range1954507 1 28 33 annotation1954506 1 NgoMIV range1954506 1 4 9 BBa_I757013_sequence 1 atggccggccatcatcatcatcatcataccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z