BBa_I757014 1 Strep-Tag Strep-Tag II affinity tag 2007-10-23T11:00:00Z 2015-08-31T04:08:07Z synthetic DNA by GeneArt * Strep tag as NgoMIV / AgeI protein fusion part * iGEM Team Freiburg 2007 false true _125_ 0 2006 9 It's complicated false between BioBrick 1.0 sites part is flanked 5' by NgoMIV and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions false iGEM Team Freiburg 2007 annotation2040664 1 StrepTagII range2040664 1 1 24 BBa_I757014_sequence 1 tggagccatccgcagtttgaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z