BBa_I759031 1 BBa_I759031 Constitutive cro 2007-10-23T11:00:00Z 2015-08-31T04:08:07Z Deborah Released HQ 2013 Deborah false false _115_ 0 253 6 In stock false Deborah false Josh Michener component1954524 1 BBa_I759002 component1954527 1 BBa_B0012 component1954525 1 BBa_B0010 annotation1954527 1 BBa_B0012 range1954527 1 409 449 annotation1954525 1 BBa_B0010 range1954525 1 321 400 annotation1954524 1 BBa_I759002 range1954524 1 1 312 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_I759002 1 BBa_I759002 pTet-spacer-cro 2007-06-26T11:00:00Z 2015-08-31T04:08:07Z Caltech iGEM Released HQ 2013 pTet-spacer-cro false false _115_ 0 253 6 In stock false None true Josh Michener annotation1957528 1 cro gene range1957528 1 112 312 annotation1957529 1 spacer range1957529 1 55 111 annotation1957527 1 pTet range1957527 1 1 54 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I759002_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgtgcacaattcactgagtcatatgatcgatttgggtattaaagaggagaaacaattgatggaacaacgcataaccctgaaagattatgcaatgcgctttgggcaaaccaagacagctaaagatctcggcgtatatcaaagcgcgatcaacaaggccattcatgcaggccgaaagatttttttaactataaacgctgatggaagcgtttatgcggaagaggtaaagcccttcccgagtaacaaaaaaacaacagcataa BBa_I759031_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgtgcacaattcactgagtcatatgatcgatttgggtattaaagaggagaaacaattgatggaacaacgcataaccctgaaagattatgcaatgcgctttgggcaaaccaagacagctaaagatctcggcgtatatcaaagcgcgatcaacaaggccattcatgcaggccgaaagatttttttaactataaacgctgatggaagcgtttatgcggaagaggtaaagcccttcccgagtaacaaaaaaacaacagcataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z