BBa_I761001 1 OmpR_BS OmpR binding site 2007-09-15T11:00:00Z 2015-08-31T04:08:08Z BBa_R0082 OmpR binding site. When position behind a promotor, it will turns that promotor into a OmpR controlled promotor. OmpR will function as an inhibitor of that promotor. false false _140_ 0 2031 9 Not in stock false This part was derived from BBa_R0082 by PCR. false 2007 NYMU_Taiwan iGEM Team annotation1944249 1 C2 OmpR range1944249 1 22 40 annotation1944250 1 C3 OmpR range1944250 1 43 60 annotation1944248 1 C1 OmpR range1944248 1 2 19 BBa_I761001_sequence 1 tacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z