BBa_I761002 1 BBa_I761002 TAT signal+INS_A 2007-10-18T11:00:00Z 2015-08-31T04:08:08Z NCBI accession number: BC005255 K12 E. coli genomic DNA Twin arginin signal peptide is an efficient protein export signal sequence of E. coli. The purpose of this construct is to allow E. coli export insulin automatically, obviate the need to extract insulin by biochemical method. false false _140_ 0 2031 9 Not in stock false To combine TAT signal and INS_A, we used two separate PCR reaction to amplify each DNA fragment. We design the reverse primer of TAT signal and the forward primer of INS_A to be complement to each other, so when we mixed the product of each PCR reaction together, than used the forward primer of TAT signal and the reverse primer of INS_A to conduct PCR reaction, we can isolate the combine DNA product of TAT signal and INS_A. (Method devised by Dr. Chang) false 2007 NYMU_Taiwan iGEM Team annotation1949759 1 Human insulin A fragment range1949759 1 89 151 annotation1949758 1 TAT peptide export signal range1949758 1 4 88 BBa_I761002_sequence 1 atggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgcaggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z