BBa_R0078 1 cinR Promoter (cinR and HSL regulated) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Rhizobium leguminosarum Released HQ 2013 false false _1_ 0 24 7 In stock false true Drew Endy annotation318234 1 unidentified/uncharacterized CinR dependent range318234 1 1 220 annotation318250 1 stem_loop range318250 1 91 136 annotation318244 1 stem_loop range318244 1 35 74 BBa_I761001 1 OmpR_BS OmpR binding site 2007-09-15T11:00:00Z 2015-08-31T04:08:08Z BBa_R0082 OmpR binding site. When position behind a promotor, it will turns that promotor into a OmpR controlled promotor. OmpR will function as an inhibitor of that promotor. false false _140_ 0 2031 9 Not in stock false This part was derived from BBa_R0082 by PCR. false 2007 NYMU_Taiwan iGEM Team annotation1944249 1 C2 OmpR range1944249 1 22 40 annotation1944250 1 C3 OmpR range1944250 1 43 60 annotation1944248 1 C1 OmpR range1944248 1 2 19 BBa_I761011 1 BBa_I761011 CinR, CinL and glucose controlled promotor 2007-10-18T11:00:00Z 2015-08-31T04:08:08Z *BBa_R0078 *BBa_I761001 This promotor is controlled by cinr, cinl and extrcellular glucose concentration. High extracellular glucose concentration will inhibit this promotor through the action of phosphorylated OmpR. Phosphorylated OmpR will bind the OmpR binding site of the promotor and block the movement of RNA polymerase. In contrast, the combined action of CinR and CinL will turn on the promotor. But only when the extracellular glucose level is low so OmpR dephosphorylate and dissociate from its binding site will this promotor become active. In essence, this promotor function as an AND gate, it will turn on if and only if the extracellular glucose level is low and there are some functional CinR and CinL protein inside the cell. false false _140_ 0 2031 9 It's complicated false The key to the function of the promotor is the inhibitory ability of OmpR binding site. To ensure maximum affinity with phosphorylated OmpR, we use all three OmpR binding site.s. false 2007 NYMU_Taiwan iGEM Team component1950118 1 BBa_R0078 component1950122 1 BBa_I761001 annotation1950118 1 BBa_R0078 range1950118 1 1 225 annotation1950122 1 BBa_I761001 range1950122 1 234 295 BBa_R0078_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgc BBa_I761001_sequence 1 tacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgt BBa_I761011_sequence 1 ccctttgtgcgtccaaacggacgcacggcgctctaaagcgggtcgcgatctttcagattcgctcctcgcgctttcagtctttgttttggcgcatgtcgttatcgcaaaaccgctgcacacttttgcgcgacatgctctgatccccctcatctgggggggcctatctgagggaatttccgatccggctcgcctgaaccattctgctttccacgaacttgaaaacgctactagagtacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z