BBa_R0082 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000193 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is taken from the upstream region of ompC. Phosphorylated OmpR binds to the three operator sites and activates transcription. false false _1_ 0 24 7 In stock false The promoter includes the three OmpR binding sites: C1, C2, and C3. The promoter starts at -107 and goes up to the transcriptional start site at +1. An alternate version, BBa_R0083, cuts out the C2 and C3 sites. The efficacy of this promoter versus the truncated ompC upstream region (BBa_R0083) or the ompF upstream region (BBa_R0084) is currently unknown. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301154 1 C1 OmpR range301154 1 13 30 annotation301166 1 -35 range301166 1 75 80 annotation301156 1 C3 OmpR range301156 1 54 71 annotation301167 1 -10 range301167 1 98 103 annotation301155 1 C2 OmpR range301155 1 34 51 BBa_I761002 1 BBa_I761002 TAT signal+INS_A 2007-10-18T11:00:00Z 2015-08-31T04:08:08Z NCBI accession number: BC005255 K12 E. coli genomic DNA Twin arginin signal peptide is an efficient protein export signal sequence of E. coli. The purpose of this construct is to allow E. coli export insulin automatically, obviate the need to extract insulin by biochemical method. false false _140_ 0 2031 9 Not in stock false To combine TAT signal and INS_A, we used two separate PCR reaction to amplify each DNA fragment. We design the reverse primer of TAT signal and the forward primer of INS_A to be complement to each other, so when we mixed the product of each PCR reaction together, than used the forward primer of TAT signal and the reverse primer of INS_A to conduct PCR reaction, we can isolate the combine DNA product of TAT signal and INS_A. (Method devised by Dr. Chang) false 2007 NYMU_Taiwan iGEM Team annotation1949758 1 TAT peptide export signal range1949758 1 4 88 annotation1949759 1 Human insulin A fragment range1949759 1 89 151 BBa_I761013 1 BBa_I761013 Insulin A generator with TAT signal peptide with glucose-inducible promoter 2007-10-25T11:00:00Z 2015-08-31T04:08:08Z glucose-inducible promoter is derived from biobrick BBa_R0082 insulin Alpha chain is derived from MGC clone (NCBI accession number: BC005255) TAT signal peptide is derived from E. coli K12 genomic DNA This construct can be induced by glucose and express insulin Alpha chain with TAT signal peptide false false _ 0 592 9 It's complicated false No double terminator in the end of this construct DNA of insulin Alpha chain has a stop codon in the end false Chih-Hsien Yang component1955901 1 BBa_I761002 component1955898 1 BBa_R0082 annotation1955898 1 BBa_R0082 range1955898 1 1 108 annotation1955901 1 BBa_I761002 range1955901 1 115 265 BBa_I761013_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacttactagatggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgcaggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgca BBa_R0082_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggact BBa_I761002_sequence 1 atggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgcaggcattgtggaacaatgctgtaccagcatctgctccctctaccagctggagaactactgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z