BBa_I766000 1 BBa_I766000 iGEMase cleaves ... something 2007-05-25T11:00:00Z 2015-08-31T04:08:09Z Isolated from unfortunate iGEM 2006 member mutant. GenBank Acc. No UCSF100000000000 This is a protease that cleaves iGEM members' hands from their pipettes after 24 hours of consecutive pipetting. true false _155_ 0 1796 9 Discontinued false no data false Sergio Peisajovich annotation1933718 1 glorious Not1 site range1933718 1 29 34 annotation1933717 1 start codon range1933717 1 1 3 BBa_I766000_sequence 1 atgggggcgggtgcacgggatcatcgccggcggcggccgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z