BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I769102 1 BBa_I769102 Feruloyl-CoA hydratase for vanillin biosynthesis 2007-06-26T11:00:00Z 2015-08-31T04:08:10Z Genbank accession: AJ536325; Microb Cell Fact. 2007; 6: 13. Published online 2007 April 16. doi: 10.1186/1475-2859-6-13. Copyright ?? 2007 Barghini et al; licensee BioMed Central Ltd. Vanillin production using metabolically engineered Escherichia coli under non-growing conditions Paolo Barghini,1 Diana Di Gioia,2 Fabio Fava,2 and Maurizio Ruzzi corresponding author1 One of two steps in the bioconversion of ferulic acid to vanillin. The enzyme is from Pseudomonas fluorescens and it does work with E. coli. It requires both ech and fcs for vanillin biosynthesis. false false _162_ 0 967 1 Not in stock false Changed stop codon to TAATAA false Mackenize Cowell annotation1935577 1 Stop codon range1935577 1 829 834 annotation1935578 1 Feruloyl-CoA hydratase (ech) range1935578 1 1 834 annotation1935576 1 Start codon range1935576 1 1 3 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_I769103 1 BBa_I769103 Feruloyl-CoA hydratase for vanillin biosynthesis protein generator 2007-06-26T11:00:00Z 2015-08-31T04:08:10Z Contains <partinfo>I769102</partinfo> This part helps to biosynthesize vanillin from ferulic acid. It also requires the other step of the vanillin biosynthesis pathway (fcs enzyme). false true _162_ 0 967 1 Not in stock false This part has a strong promoter that will generate a strong vanilla scent. false Mackenize Cowell component1935592 1 BBa_B0010 component1935594 1 BBa_B0012 component1935587 1 BBa_B0034 component1935579 1 BBa_R0010 component1935591 1 BBa_I769102 annotation1935587 1 BBa_B0034 range1935587 1 209 220 annotation1935592 1 BBa_B0010 range1935592 1 1069 1148 annotation1935591 1 BBa_I769102 range1935591 1 227 1060 annotation1935594 1 BBa_B0012 range1935594 1 1157 1197 annotation1935579 1 BBa_R0010 range1935579 1 1 200 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I769103_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgagcaactacgaaggtcgctggacaacggtcaaggtcgaaatcgaagacggcattgcctgggtcattctcaatcgtccggaaaaacgcaacgccatgagcccaaccctgaaccgggaaatgatcgacgtgctggaaaccctggaacaggacccggccgctggtgtgctggtgctgaccggcgccggcgaggcctggaccgccggcatggacctcaaggaatacttccgcgaggtggatgccgggccggagatccttcaggagaaaatccgccgcgaagcctcccagtggcagtggaaactgctgcgcatgtacgccaagccgaccatcgccatggtcaacggctggtgcttcggtggcggcttcagcccgctggtggcgtgcgatctggcgatctgcgccgacgaggccaccttcggcctgtctgaaatcaactggggcatcccgccgggcaacctggtgagcaaggccatggccgacaccgtgggccatcgccagtcgctgtactacatcatgaccggcaagactttcggcgggcagaaagccgccgaaatgggcctggtcaacgacagcgtgcccctggctcgattgcgtgaggtgaccattgagctggcgcgcaacctgctggagaaaaacccggtggtgctgcgtgccgccaagcatggcttcaagcgttgccgcgagctgacctgggagcagaacgaagactacctgtacgccaagctcgatcagtcgcgcctgttggacaccgaaggcggccgcgagcagggcatgaagcagtttctcgacgacaagagcatcaagcccggcctgcaggcgtataaacgctaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_I769102_sequence 1 atgagcaactacgaaggtcgctggacaacggtcaaggtcgaaatcgaagacggcattgcctgggtcattctcaatcgtccggaaaaacgcaacgccatgagcccaaccctgaaccgggaaatgatcgacgtgctggaaaccctggaacaggacccggccgctggtgtgctggtgctgaccggcgccggcgaggcctggaccgccggcatggacctcaaggaatacttccgcgaggtggatgccgggccggagatccttcaggagaaaatccgccgcgaagcctcccagtggcagtggaaactgctgcgcatgtacgccaagccgaccatcgccatggtcaacggctggtgcttcggtggcggcttcagcccgctggtggcgtgcgatctggcgatctgcgccgacgaggccaccttcggcctgtctgaaatcaactggggcatcccgccgggcaacctggtgagcaaggccatggccgacaccgtgggccatcgccagtcgctgtactacatcatgaccggcaagactttcggcgggcagaaagccgccgaaatgggcctggtcaacgacagcgtgcccctggctcgattgcgtgaggtgaccattgagctggcgcgcaacctgctggagaaaaacccggtggtgctgcgtgccgccaagcatggcttcaagcgttgccgcgagctgacctgggagcagaacgaagactacctgtacgccaagctcgatcagtcgcgcctgttggacaccgaaggcggccgcgagcagggcatgaagcagtttctcgacgacaagagcatcaagcccggcctgcaggcgtataaacgctaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z