BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_I769106 1 BBa_I769106 ech protein generator for vanillin biosynthesis 2007-06-26T11:00:00Z 2015-08-31T04:08:10Z Uses <partinfo>BBa_I769105</partinfo> as well as a promoter, RBS, and terminator. Uses IPTG inducible promoter in order to test construct. Contains high efficiency RBS and terminator. This part helps to synthesize vanillin from ferulic acid with the help of fcs. false true _162_ 0 457 67 Not in stock true Needs to be used in conjunction with fcs in order to generate vanillin. false Meagan Lizarazo component1935823 1 BBa_R0011 component1935836 1 BBa_B0011 component1935832 1 BBa_B0012 component1935829 1 BBa_B0034 component1935831 1 BBa_I769104 annotation1935836 1 BBa_B0011 range1935836 1 970 1015 annotation1935823 1 BBa_R0011 range1935823 1 1 54 annotation1935831 1 BBa_I769104 range1935831 1 82 912 annotation1935829 1 BBa_B0034 range1935829 1 64 75 annotation1935832 1 BBa_B0012 range1935832 1 921 961 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_I769104 1 BBa_I769104 Feruloyl CoA hydratase for vanillin biosythesis 2007-06-26T11:00:00Z 2015-08-31T04:08:10Z Genbank AJ536325 Microb Cell Fact. 2007; 6: 13. Published online 2007 April 16. doi: 10.1186/1475-2859-6-13. Copyright ?? 2007 Barghini et al; licensee BioMed Central Ltd. Vanillin production using metabolically engineered Escherichia coli under non-growing conditions Paolo Barghini,1 Diana Di Gioia,2 Fabio Fava,2 and Maurizio Ruzzicorresponding author1 One of two steps in the bioconversion of freulic acid to vanillin. Comes from Pseudomonas flourescens and works in E. coli. Biosynthesis requires both ech and fcs. false true _162_ 0 457 67 Not in stock false Needs fcs and ech false Meagan Lizarazo annotation1935603 1 Feruloyl CoA hydratase (ech) range1935603 1 1 831 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_I769104_sequence 1 atgagcaactacgaaggtcgctggacaacggtcaaggtcgaaatcgaagacggcattgcctgggtcattctcaatcgtccggaaaaacgcaacgccatgagcccaaccctgaaccgggaaatgatcgacgtgctggaaaccctggaacaggacccggccgctggtgtgctggtgctgaccggcgccggcgaggcctggaccgccggcatggacctcaaggaatacttccgcgaggtggatgccgggccggagatccttcaggagaaaatccgccgcgaagcctcccagtggcagtggaaactgctgcgcatgtacgccaagccgaccatcgccatggtcaacggctggtgcttcggtggcggcttcagcccgctggtggcgtgcgatctggcgatctgcgccgacgaggccaccttcggcctgtctgaaatcaactggggcatcccgccgggcaacctggtgagcaaggccatggccgacaccgtgggccatcgccagtcgctgtactacatcatgaccggcaagactttcggcgggcagaaagccgccgaaatgggcctggtcaacgacagcgtgcccctggctcgattgcgtgaggtgaccattgagctggcgcgcaacctgctggagaaaaacccggtggtgctgcgtgccgccaagcatggcttcaagcgttgccgcgagctgacctgggagcagaacgaagactacctgtacgccaagctcgatcagtcgcgcctgttggacaccgaaggcggccgcgagcagggcatgaagcagtttctcgacgacaagagcatcaagcccggcctgcaggcgtataaacgctga BBa_B0034_sequence 1 aaagaggagaaa BBa_I769106_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgagcaactacgaaggtcgctggacaacggtcaaggtcgaaatcgaagacggcattgcctgggtcattctcaatcgtccggaaaaacgcaacgccatgagcccaaccctgaaccgggaaatgatcgacgtgctggaaaccctggaacaggacccggccgctggtgtgctggtgctgaccggcgccggcgaggcctggaccgccggcatggacctcaaggaatacttccgcgaggtggatgccgggccggagatccttcaggagaaaatccgccgcgaagcctcccagtggcagtggaaactgctgcgcatgtacgccaagccgaccatcgccatggtcaacggctggtgcttcggtggcggcttcagcccgctggtggcgtgcgatctggcgatctgcgccgacgaggccaccttcggcctgtctgaaatcaactggggcatcccgccgggcaacctggtgagcaaggccatggccgacaccgtgggccatcgccagtcgctgtactacatcatgaccggcaagactttcggcgggcagaaagccgccgaaatgggcctggtcaacgacagcgtgcccctggctcgattgcgtgaggtgaccattgagctggcgcgcaacctgctggagaaaaacccggtggtgctgcgtgccgccaagcatggcttcaagcgttgccgcgagctgacctgggagcagaacgaagactacctgtacgccaagctcgatcagtcgcgcctgttggacaccgaaggcggccgcgagcagggcatgaagcagtttctcgacgacaagagcatcaagcccggcctgcaggcgtataaacgctgatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z