BBa_I769900 1 BBa_I769900 fibronectin monomer 2007-08-01T11:00:00Z 2015-08-31T04:08:10Z GenBank -- Accession No. K00800.1 [GI:163055] Fibronectin is a key component of the extracellular matrix of all vertebrates. It a large glycoprotein dimer composed of two very large subunits joined by disulfide bonds at one end. Each subunit is folded into a series of functionally distinct domains separated by regions of flexible polypeptide chain. false false _41_1_ 0 1294 165 Not in stock false The actual subdomain is only the first 45 amino acid residues; thus we chose to synthesize the appropriate BioBrick-ended sequence, rather than isolate it from a natural source. false Scott Mohr annotation1940670 1 fibronectin type I domain range1940670 1 4 291 BBa_I769900_sequence 1 ctcatgaggccacgtgctatgacgatgggaagacttaccacgtgggagaacagtggcagaaggaatatcttggtgccatttgctcctgcacatgctttggaggccagcggggctggcgctgtgacaactgccgcagacctggggctgaacccggtaacgaaggctccactgcccactcctacaaccagtattcccagagataccatcagagaacaaacactaatgtcaactgcccaattgagtgcttcatgcctttggatgtacaggctgacagagaagattcccgagagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z