BBa_I769901 1 BBa_I769901 Thermoanaerobacter tengcongensis SASP 2007-08-01T11:00:00Z 2015-08-31T04:08:10Z Thermoanaerobacter tengcongensis MB4. Sequence taken from GenBank:[gi:20807277].AE013046. See reference: Bao,Q., Tian,Y., Li,W., Xu,Z., Xuan,Z., Hu,S., Dong,W., Yang,J., Chen,Y., Xue,Y., Xu,Y., Lai,X., Huang,L., Dong,X., Ma,Y., Ling,L., Tan,H., Chen,R., Wang,J., Yu,J. and Yang,H. TITLE A Complete Sequence of the T. tengcongensis Genome JOURNAL Genome Res. 12 (5), 689-700 (2002) Small, acid-soluble spore protein from Thermoanaerobacter tengcongensis MB4. One of the SASP family of DNA-binding proteins that help package spore DNA and protect it from light, heat and dessication. This protein may be potentially useful in developing a strain of E. coli that will sporulate, thereby facilitating successful long-term storage at room temperature. false false _41_1_ 0 1294 165 Not in stock false None false Scott Mohr annotation1940675 1 stop range1940675 1 304 309 annotation1940674 1 coding sequence range1940674 1 1 303 annotation1940673 1 start range1940673 1 1 3 BBa_I769901_sequence 1 atggcaagaggaagctggaatgacaggccaaaaatggtaccagaggctcataaagctcttgacaacatgaaatacgaaatcgcctcagaattaggtttgcctgtaaaacaagggtctgaagattactggggacatataagcagtagagactgcggaaaagtaggaggacaaatgttaaggcgaatggttcatttcgcagaatcggcaatggctagaggcatcagcatatatggttctccccctgcacaaggcggtcagcaaggccttgcaggcagtgaatcagagtatatgcaaagaaggtcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z