BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I769903 1 BBa_I769903 test 2009-05-14T11:00:00Z 2015-08-31T04:08:10Z test test false false _162_ 0 126 162 Not in stock false test false Reshma Shetty component2003076 1 BBa_B0034 component2003078 1 BBa_B0012 component2003082 1 BBa_B0011 component2003077 1 BBa_I769902 annotation2003077 1 BBa_I769902 range2003077 1 21 73 annotation2003082 1 BBa_B0011 range2003082 1 131 176 annotation2003076 1 BBa_B0034 range2003076 1 1 12 annotation2003078 1 BBa_B0012 range2003078 1 82 122 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I769902 1 BBa_I769902 test 2009-05-14T11:00:00Z 2015-08-31T04:08:10Z test test false false _162_ 0 126 162 Not in stock false test false Reshma Shetty BBa_I769903_sequence 1 aaagaggagaaatactagaggcatgactgcgtcagtacgtacgtacgagcgacgtacgtactgcagtacgtactactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_I769902_sequence 1 gcatgactgcgtcagtacgtacgtacgagcgacgtacgtactgcagtacgtac BBa_B0034_sequence 1 aaagaggagaaa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z