BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation23330 1 SsrA range23330 1 621 654 annotation2213989 1 Help:Barcodes range2213989 1 661 685 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0052 1 cI 434 Promoter (434 cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage 434 right operator Released HQ 2013 The 434 cI regulatory region sequence is a 89 base-pair sequence with the standard BioBrick prefix and suffix sections on its ends. 434 cI repressor protein, <bb_part>BBa_C0052<bb_part>, binds to it.<br> This segment contains O-R1, O-R2, P-R, and P-RM -35.</p> false false _1_ 0 24 7 In stock false <P> <P><P> true Maia Mahoney annotation2026 1 OR2 range2026 1 1 43 annotation7068 1 BBa_R0052 range7068 1 1 46 annotation2031 1 -35 range2031 1 2 7 annotation2029 1 -35 range2029 1 1 6 annotation2027 1 OR2 range2027 1 8 21 annotation2028 1 OR1 range2028 1 30 43 annotation2030 1 -10 range2030 1 24 29 annotation2032 1 start range2032 1 35 37 BBa_R0050 1 cI HK022 Promoter (HK022 cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Bacteriophage HK022. The pR regulatory region is a 98 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two operator sites at which HK022 cI protein can bind cooperatively. The -35 and -10 regions from pR are included along with some flanking sequences. The cutoff for the 5' end of the regulatory region was placed just after the pM -10 region which promotes transcription of a gene upstream (thus the pM -10 region is not included). The cutoff for the 3' end of the regulatory region was placed immediately prior to the RBS. </p> false false _1_ 0 24 7 It's complicated false <P> <P>Derived from <genbank>STHK022N</genbank>.<P> Literature claims that there is no cross-talk between HK022 cI regulatory region, Lambda cI, 434 cI and P22 cI, but this has not been verified experimentally by the synthetic biology group at MIT. false Reshma Shetty annotation2013 1 OR2 range2013 1 13 27 annotation2014 1 -10 range2014 1 30 35 annotation2012 1 -35 range2012 1 8 13 annotation2018 1 putative range2018 1 43 43 annotation7066 1 BBa_R0050 range7066 1 1 55 annotation2015 1 OR1 range2015 1 37 51 BBa_C0052 1 cI 434 cI repressor from phage 434 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage 434 Released HQ 2013 The 434 cI repressor protein coding sequence is a 710 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the 434 regulatory sequence, BBa_R0052. The sequence contains a LVA tag for faster degredation and has no RBS.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P> References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P><P> true Maia Mahoney annotation2213992 1 Help:Barcodes range2213992 1 670 694 annotation1745 1 LVA range1745 1 631 669 annotation1743 1 cI 434 range1743 1 1 669 annotation7035 1 BBa_C0052 range7035 1 1 669 BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2159 1 2 range2159 1 757 762 annotation2161 1 A (Q->L) range2161 1 242 242 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2156 1 YFP (LVA) range2156 1 1 762 annotation2160 1 SsrA range2160 1 718 756 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2023 1 -35 range2023 1 15 20 annotation2024 1 OR1 range2024 1 25 41 annotation2025 1 OR2 range2025 1 1 17 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2022 1 -10 range2022 1 38 43 BBa_C0071 1 rhlR rhlR repressor/activator from P. aeruginosa PA3477 (+LVA) 2004-01-26T12:00:00Z 2015-08-31T04:07:23Z P. aeruginosa PA3477 Released HQ 2013 Transcriptional regulator, in complex with N-butyryl-HSL, RhlR binds to the Rhl promoter false false _1_ 0 24 7 In stock false (1/28/04 Edit Jamboree) (0) No BB sites (1) ATG (2) TAATAA (3) Blast checks out (4) No codon changes (5) Maybe chassis compatability (check by experiment) (6) Codon usage not optimal (but looks OK) (7) ssrA tag added true Debra Lin, Srini Devadas, David Gray, Ronny Krashinsky, and Chris Zheng Liu, Boopers annotation301192 1 rhlR range301192 1 1 723 annotation306523 1 LVA range306523 1 724 756 annotation2213995 1 Help:Barcodes range2213995 1 763 787 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation23334 1 cI lambda range23334 1 4 711 annotation23335 1 LVA range23335 1 712 744 annotation2213991 1 Help:Barcodes range2213991 1 751 775 BBa_C0050 1 cI HK022 cI repressor from phage HK022 (+LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage HK022. Released HQ 2013 Coding region for the HK022 bacteriophage cI protein. cI binds to the HK022 pR regulator (BBa_R0050). It represses transcription of the protein encoded by the sequence 3' to the pR region. This coding sequence does not contain a RBS.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P> References (unparsed) here: <p>Carlson NG, Little JW. Highly cooperative DNA binding by the coliphage HK022 repressor. J Mol Biol. 1993 Apr 20;230(4):1108-30.<br> PMID: 8487297.</P> <P> Mao C, Little JW. Mutations affecting cooperative DNA binding of phage HK022 CI repressor.<br> J Mol Biol. 1998 May 29;279(1):31-48. PMID: 9636698.</P> <p></p> <p></p> <P>Derived from <genbank>STHK022N</genbank>.<br> <br> Response from John Little (Arizona) regarding the start of HK022 cI<br> <br> From: <jlittle@email.arizona.edu> <br> Date: Tue Jan 21, 2003 4:39:21 PM US/Eastern <br> To: "Drew Endy" <endy@MIT.EDU><br> Subject: RE: hk022 cI start (naive question)? <br> Hello Drew and Michael, I seriously doubt that the extra 27 aa are part of CI. It doesn't make sense in terms of the biology, for sure. In any case, the protein we characterized starts where Carlson and Little stated; as I recall, oR3 partially overlaps the start of cI. I have a vague memory of some possibly interesting biology, having to do with multicopy plasmids. I don't recall the findings themselves. Anyway, one possible explanation was that this extra N-terminal addition was made (e.g. from the pRE promoter, or from a message that arose from transcription around the entire plasmid), making a protein with altered functions. We never followed it up. <br> Good luck <br> John<br> <br> -- Original Message -- <br> Date: Sun, 19 Jan 2003 15:26:26 -0500 <br> Subject: hk022 cI start (naive question)? <br> Cc: elowitm@rockefeller.edu <br> To: jlittle@u.arizona.edu <br> From: Drew Endy <endy@MIT.EDU> <br> Hi John, I'm sitting here with Michael Elowitz and we're working through the sequence for HK022 cI. We noticed that the annotation from NC_002166 includes an "extra" 81 base pairs upstream of what we thought of as the actual start. It looks like this extra DNA extends into the PR regulatory region. We're wondering what's going on here? I'm guessing this is well documented somewhere. Thanks for any pointers/info! <br> Drew<P> It is unknown whether there is cross-talk between this repressor and Lambda cI regulatory region, 434 cI regulatory region and P22 regulatory region. true Reshma Shetty annotation1735 1 cI HK022 range1735 1 1 744 annotation2213990 1 Help:Barcodes range2213990 1 745 769 annotation1737 1 OR3 partial range1737 1 1 8 annotation1734 1 2 range1734 1 739 744 annotation7033 1 BBa_C0050 range7033 1 1 744 annotation1736 1 SsrA range1736 1 706 738 BBa_I8023 1 BBa_I8023 Booperator test: Inverter NOR biasing in polycistronic design 2004-01-29T12:00:00Z 2015-08-31T04:08:11Z This is the fourth test chassis for the Booperator and is particular to the polycistronic design. It tests the biasing of the Inverter NOR pair. false false _1_ 0 24 7 Not in stock false false Srini Devadas, David Gray, Ronny Krashinsky, Debra Lin, and Chris Zheng Liu component1005537 1 BBa_B0012 component1005448 1 BBa_R0050 component1005817 1 BBa_B0012 component1005591 1 BBa_B0010 component1005807 1 BBa_B0010 component1005633 1 BBa_B0034 component1005678 1 BBa_R0040 component1005745 1 BBa_C0071 component1005568 1 BBa_C0051 component1005484 1 BBa_B0012 component1005735 1 BBa_B0034 component1005574 1 BBa_B0034 component1005499 1 BBa_R0051 component1005527 1 BBa_B0010 component1005727 1 BBa_R0040 component1005696 1 BBa_C0040 component1005712 1 BBa_B0012 component1005702 1 BBa_B0010 component1005686 1 BBa_B0034 component1005799 1 BBa_C0062 component1005399 1 BBa_B0034 component1005663 1 BBa_B0012 component1005468 1 BBa_C0051 component1005553 1 BBa_R0071 component1005422 1 BBa_B0010 component1005784 1 BBa_B0034 component1005761 1 BBa_B0012 component1005584 1 BBa_C0052 component1005645 1 BBa_E0032 component1005776 1 BBa_R0040 component1005519 1 BBa_E0032 component1005558 1 BBa_B0034 component1005432 1 BBa_B0012 component1005623 1 BBa_R0052 component1005414 1 BBa_C0050 component1005601 1 BBa_B0012 component1005653 1 BBa_B0010 component1005751 1 BBa_B0010 component1005458 1 BBa_B0034 component1005474 1 BBa_B0010 component1005507 1 BBa_B0034 component1005391 1 BBa_R0062 annotation1005776 1 BBa_R0040 range1005776 1 7599 7652 annotation1005653 1 BBa_B0010 range1005653 1 5540 5619 annotation1005751 1 BBa_B0010 range1005751 1 7462 7541 annotation1005537 1 BBa_B0012 range1005537 1 2930 2970 annotation1005568 1 BBa_C0051 range1005568 1 3058 3807 annotation1005422 1 BBa_B0010 range1005422 1 859 938 annotation1005591 1 BBa_B0010 range1005591 1 4561 4640 annotation1005584 1 BBa_C0052 range1005584 1 3859 4527 annotation1005484 1 BBa_B0012 range1005484 1 1948 1988 annotation1005678 1 BBa_R0040 range1005678 1 5677 5730 annotation1005686 1 BBa_B0034 range1005686 1 5739 5750 annotation1005399 1 BBa_B0034 range1005399 1 64 75 annotation1005761 1 BBa_B0012 range1005761 1 7550 7590 annotation1005474 1 BBa_B0010 range1005474 1 1860 1939 annotation1005553 1 BBa_R0071 range1005553 1 2979 3031 annotation1005414 1 BBa_C0050 range1005414 1 82 825 annotation1005745 1 BBa_C0071 range1005745 1 6667 7428 annotation1005633 1 BBa_B0034 range1005633 1 4752 4763 annotation1005499 1 BBa_R0051 range1005499 1 1997 2045 annotation1005448 1 BBa_R0050 range1005448 1 996 1050 annotation1005645 1 BBa_E0032 range1005645 1 4770 5531 annotation1005623 1 BBa_R0052 range1005623 1 4698 4743 annotation1005702 1 BBa_B0010 range1005702 1 6450 6529 annotation1005727 1 BBa_R0040 range1005727 1 6587 6640 annotation1005574 1 BBa_B0034 range1005574 1 3841 3852 annotation1005807 1 BBa_B0010 range1005807 1 8468 8547 annotation1005507 1 BBa_B0034 range1005507 1 2054 2065 annotation1005558 1 BBa_B0034 range1005558 1 3040 3051 annotation1005799 1 BBa_C0062 range1005799 1 7679 8434 annotation1005458 1 BBa_B0034 range1005458 1 1059 1070 annotation1005817 1 BBa_B0012 range1005817 1 8556 8596 annotation1005391 1 BBa_R0062 range1005391 1 1 55 annotation1005468 1 BBa_C0051 range1005468 1 1077 1826 annotation1005527 1 BBa_B0010 range1005527 1 2842 2921 annotation1005601 1 BBa_B0012 range1005601 1 4649 4689 annotation1005519 1 BBa_E0032 range1005519 1 2072 2833 annotation1005432 1 BBa_B0012 range1005432 1 947 987 annotation1005663 1 BBa_B0012 range1005663 1 5628 5668 annotation1005696 1 BBa_C0040 range1005696 1 5757 6416 annotation1005712 1 BBa_B0012 range1005712 1 6538 6578 annotation1005784 1 BBa_B0034 range1005784 1 7661 7672 annotation1005735 1 BBa_B0034 range1005735 1 6649 6660 BBa_R0071 1 RhlR+C4 Promoter (RhlR & C4-HSL regulated) 2004-01-24T12:00:00Z 2015-05-08T01:14:15Z <i>Pseudomonas aeruginosa</i> rhlAB promoter Released HQ 2013 Promoter activated by RhlR in concert with C4-HSL. C4-HSL is produced by RhlI, and acts as a quorum-sensing autoinducer. <p> This is the natural sequence taken from Pseudomonas aeruginosa. <p> Crosstalk: this promoter is also activated at a low level by LasR with its associated HSL. false false _1_ 0 24 7 In stock false The -10 and -35 sites are labeled as identified in [Pearson97]. <P> The part begins with the RhlR binding site, and (rather arbitrarily) ends with the first transcribed base (+1). true Ronny Krashinsky annotation297103 1 -35 range297103 1 19 24 annotation297104 1 -10 range297104 1 42 47 annotation297102 1 RhlR range297102 1 1 20 annotation297105 1 start range297105 1 53 53 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2046 1 -35 range2046 1 20 25 annotation2045 1 LuxR/HSL range2045 1 1 20 annotation2047 1 -10 range2047 1 42 47 annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2048 1 start range2048 1 53 53 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_C0062 1 luxr luxR repressor/activator, (no LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 In complex with HSL, LuxR binds to the Lux promoter, activating transcription from Pr <bb_part>BBa_R0062</bb_part>, and repressing transcription from Pl <bb_part>BBa_R0063</bb_part>. <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux activator, LuxR complexed to HSL. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false true _1_ 0 24 7 In stock false <P> <P>2 silent point mutants were introduced in the coding sequence to remove internal XbaI and PstI sites. Mutation sites were chosen to replace codons commonly used in <em>E. coli</em> with codons used at a similar frequency. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7039 1 BBa_C0062 range7039 1 1 756 annotation2213986 1 Help:Barcodes range2213986 1 757 781 annotation1766 1 luxR range1766 1 1 750 annotation1764 1 T range1764 1 174 174 annotation1762 1 prefix range1762 1 1 2 annotation1765 1 A range1765 1 492 492 BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0052_sequence 1 ttgacaaacaagatacattgtatgaaaatacaagaaagtttgttga BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_C0052_sequence 1 atgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_C0050_sequence 1 atggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccc BBa_C0071_sequence 1 atgaggaatgacggaggctttttgctgtggtgggacggtttgcgtagcgagatgcagccgatccacgacagccagggcgtgttcgccgtcctggaaaaggaagtgcggcgcctgggcttcgattactacgcctatggcgtgcgccacacgattcccttcacccggccgaagaccgaggtccatggcacctatcccaaggcctggctggagcgataccagatgcagaactacggggccgtggatccggcgatcctcaacggcctgcgctcctcggaaatggtggtctggagcgacagcctgttcgaccagagccggatgctctggaacgaggctcgcgattggggcctctgtgtcggcgcgaccttgccgatccgcgcgccgaacaatttgctcagcgtgctttccgtggcgcgcgaccagcagaacatctccagcttcgagcgcgaggaaatccgcctgcggctgcgttgcatgatcgagttgctgacccagaagctgaccgacctggagcatccgatgctgatgtccaacccggtctgcctgagccatcgcgaacgcgagatcctgcaatggaccgccgacggcaagagttccggggaaatcgccatcatcctgagcatctccgagagcacggtgaacttccaccacaagaacatccagaagaagttcgacgcgccgaacaagacgctggctgccgcctacgccgcggcgctgggtctcatcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_R0071_sequence 1 tcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttc BBa_I8023_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaaagaggagaaatactagatggttcaacagaaagagcgtgaaactttctcgcagaggcttgcgctggcctgtgataaagcgggattacctttgcatggtaggcaggctgatttagctgtcaggcttaaggtcacaccaaaagccattagtaaatggttcaacggggagtcaataccaagaaaagacaagatggaatctctggcttcggtgctgggaactactgctgcatatctgcatggctatgctgatgatgacggtatcacggtaaatcatctatcaagatcaaatgattattatcgtgttgatgtattggatgttcaggcgagcgccgggccaggaaccatggtttccaatgaatttatagaaaagataagagcaattgaatatacgaccgagcaggcaagaattttatttaatggaaggccacaggaaagcgtaaaagtcatcacggttcgcggtgacagcatggagggaaccatcaatccgggagatgagatctttgttgatgtatccataacctgttttgatggcgatggcatttatgtgtttgtatacgggaaaacaatgcacgttaagcgcctgcaaatgcaaaagaacaggcttgccgtcatctctgacaatgccgcttatgatcgatggtacatagaagaaggtgaagaagagcaacttcacattctagccaaagtcctcattaggcagtcaatcgattacaagcgattcggagctgcaaacgacgaaaactacgctttagtagcttaataaccctgatagtgctagtgtagatccctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttaggtattgactgtactatcagttccgtcataatatgaaccataagttcaccactactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtcctgtgaaatctggcagttaccgttagctttcgaattggctaaaaagtgttctactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagaaagaggagaaatactagatgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgacaaacaagatacattgtatgaaaatacaagaaagtttgttgatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaggaatgacggaggctttttgctgtggtgggacggtttgcgtagcgagatgcagccgatccacgacagccagggcgtgttcgccgtcctggaaaaggaagtgcggcgcctgggcttcgattactacgcctatggcgtgcgccacacgattcccttcacccggccgaagaccgaggtccatggcacctatcccaaggcctggctggagcgataccagatgcagaactacggggccgtggatccggcgatcctcaacggcctgcgctcctcggaaatggtggtctggagcgacagcctgttcgaccagagccggatgctctggaacgaggctcgcgattggggcctctgtgtcggcgcgaccttgccgatccgcgcgccgaacaatttgctcagcgtgctttccgtggcgcgcgaccagcagaacatctccagcttcgagcgcgaggaaatccgcctgcggctgcgttgcatgatcgagttgctgacccagaagctgaccgacctggagcatccgatgctgatgtccaacccggtctgcctgagccatcgcgaacgcgagatcctgcaatggaccgccgacggcaagagttccggggaaatcgccatcatcctgagcatctccgagagcacggtgaacttccaccacaagaacatccagaagaagttcgacgcgccgaacaagacgctggctgccgcctacgccgcggcgctgggtctcatcgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_R0050_sequence 1 ttaggtattgactgtactatcagttccgtcataatatgaaccataagttcaccac BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0062_sequence 1 atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z