BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2046 1 -35 range2046 1 20 25 annotation2047 1 -10 range2047 1 42 47 annotation2048 1 start range2048 1 53 53 annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2045 1 LuxR/HSL range2045 1 1 20 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2160 1 SsrA range2160 1 718 756 annotation2161 1 A (Q->L) range2161 1 242 242 annotation7041 1 BBa_E0032 range7041 1 1 762 annotation2156 1 YFP (LVA) range2156 1 1 762 annotation2159 1 2 range2159 1 757 762 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I8031 1 BBa_I8031 Booperator aiia test: degradation of HSL "A" by aiia 2004-01-31T12:00:00Z 2015-08-31T04:08:11Z false false _1_ 0 24 7 Not in stock false false Srini Devadas, David Gray, Ronny Krashinsky, Debra Lin, and Chris Zheng Liu component976602 1 BBa_B0034 component976625 1 BBa_B0034 component976617 1 BBa_C0062 component976681 1 BBa_B0034 component976586 1 BBa_B0034 component976640 1 BBa_C0060 component976648 1 BBa_B0010 component976596 1 BBa_C0040 component976711 1 BBa_B0012 component976658 1 BBa_B0012 component976578 1 BBa_R0040 component976701 1 BBa_B0010 component976693 1 BBa_E0032 component976673 1 BBa_R0062 annotation976693 1 BBa_E0032 range976693 1 2639 3400 annotation976681 1 BBa_B0034 range976681 1 2621 2632 annotation976586 1 BBa_B0034 range976586 1 63 74 annotation976617 1 BBa_C0062 range976617 1 792 1547 annotation976578 1 BBa_R0040 range976578 1 1 54 annotation976673 1 BBa_R0062 range976673 1 2558 2612 annotation976701 1 BBa_B0010 range976701 1 3409 3488 annotation976596 1 BBa_C0040 range976596 1 81 740 annotation976625 1 BBa_B0034 range976625 1 1581 1592 annotation976711 1 BBa_B0012 range976711 1 3497 3537 annotation976640 1 BBa_C0060 range976640 1 1599 2387 annotation976648 1 BBa_B0010 range976648 1 2421 2500 annotation976658 1 BBa_B0012 range976658 1 2509 2549 annotation976602 1 BBa_B0034 range976602 1 774 785 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23329 1 tetR range23329 1 4 620 annotation23330 1 SsrA range23330 1 621 654 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986787 1 -10 range1986787 1 43 48 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 BBa_C0060 1 aiiA autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <genbank>AF196486</genbank> from <em>Bacillus</em> sp. 240B1 putative metallohydrolase (<em>aiiA</em>) gene. <BR> Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000).<br> Released HQ 2013 Coding region for the autoinducer inactivation enzyme A (<em>aiiA</em>) LVA tagged. The gene was originally isolated from <em>Bacillus</em> sp. 240B1 and it encodes an enzyme that catalyzes the degradation of N-acyl homoserine lactones (AHLs)--quorum sensing autoinducers.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P> References (unparsed) here: <p>Dong,Y.H., Xu,J.L., Li,X.Z. and Zhang,L.H.: AiiA, an enzyme that inactivates the acylhomoserine lactone quorum-sensing signal and attenuates the virulence of <em>Erwinia<br> carotovora</em>, Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3526-3531 (2000). <a href="#">http://www.pnas.org/cgi/content/full/97/7/3526</a></P> <P>Lee SJ, Park SY, Lee JJ, Yum DY, Koo BT, Lee JK.: Genes encoding the N-acyl homoserine lactone-degrading enzyme are widespread in many subspecies of Bacillus thuringiensis, Appl Environ Microbiol 2002 Aug;68(8):3919-24. <a href="#">http://aem.asm.org/cgi/content/full/68/8/3919?view=full&pmid=12147491</a><br> <br> </P> <P>BBa_C0060 insert contains open reading frame (nucleotides 49-801) of the GeneBank sequence AF196486 followed by the LVA tag and two double stop codons inserted in the BioBrick prefix and suffix flanking regions. The original stop codon was TAG and in the present sequence it was substituted by TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita D. Marinescu and Alexander D. Wissner-Gross annotation1756 1 LVA range1756 1 751 783 annotation1757 1 aiiA range1757 1 1 750 annotation7037 1 BBa_C0060 range7037 1 1 789 annotation1755 1 2 range1755 1 784 789 annotation2213987 1 Help:Barcodes range2213987 1 790 814 annotation1754 1 start range1754 1 1 3 BBa_C0062 1 luxr luxR repressor/activator, (no LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 In complex with HSL, LuxR binds to the Lux promoter, activating transcription from Pr <bb_part>BBa_R0062</bb_part>, and repressing transcription from Pl <bb_part>BBa_R0063</bb_part>. <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux activator, LuxR complexed to HSL. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false true _1_ 0 24 7 In stock false <P> <P>2 silent point mutants were introduced in the coding sequence to remove internal XbaI and PstI sites. Mutation sites were chosen to replace codons commonly used in <em>E. coli</em> with codons used at a similar frequency. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2213986 1 Help:Barcodes range2213986 1 757 781 annotation1762 1 prefix range1762 1 1 2 annotation1764 1 T range1764 1 174 174 annotation1765 1 A range1765 1 492 492 annotation7039 1 BBa_C0062 range7039 1 1 756 annotation1766 1 luxR range1766 1 1 750 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_I8031_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcactactagagaaagaggagaaatactagatgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_C0060_sequence 1 atgacagtaaagaagctttatttcgtcccagcaggtcgttgtatgttggatcattcgtctgttaatagtacattaacaccaggagaattattagacttaccggtttggtgttatcttttggagactgaagaaggacctattttagtagatacaggtatgccagaaagtgcagttaataatgaaggtctttttaacggtacatttgtcgaagggcaggttttaccgaaaatgactgaagaagatagaatcgtgaatattttaaaacgggttggttatgagccggaagaccttctttatattattagttctcacttgcattttgatcatgcaggaggaaatggcgcttttataaatacaccaatcattgtacagcgtgctgaatatgaggcggcgcagcatagcgaagaatatttgaaagaatgtatattgccgaatttaaactacaaaatcattgaaggtgattatgaagtcgtaccaggagttcaattattgcatacaccaggccatactccagggcatcaatcgctattaattgagacagaaaaatccggtcctgtattattaacgattgatgcatcgtatacgaaagagaattttgaaaatgaagtgccatttgcgggatttgattcagaattagctttatcttcaattaaacgtttaaaagaagtggtgatgaaagagaagccgattgttttctttggacatgatatagagcaggaaaggggatgtaaagtgttccctgaatatatagctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0062_sequence 1 atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z