BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_I9006 1 BBa_I9006 nor_input (tp901-cI) B0034.C0075.B0015 2004-01-27T12:00:00Z 2015-08-31T04:08:11Z false false _1_ 0 24 7 Not in stock false false crackdots component944251 1 BBa_C0075 component944241 1 BBa_B0034 component944257 1 BBa_B0010 component944267 1 BBa_B0012 annotation944267 1 BBa_B0012 range944267 1 719 759 annotation944251 1 BBa_C0075 range944251 1 19 597 annotation944257 1 BBa_B0010 range944257 1 631 710 annotation944241 1 BBa_B0034 range944241 1 1 12 BBa_C0075 1 cI TP901 TP901 cI repressor from phage TP901-1 (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:23Z TP901-1 Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false Dimeric repressor from bacteriophage TP901-1 with dissociation constant of 2*10^-9.<br/><br/> Sequence was translated with the E.Coli K12 codon usage table, and nucleotides 84-86 was changed from TTC to TTT to avoid the cut site GAATTC (81-86).<br/><br/> Bronsted, L., Hammer, K., Johansen, A.H., 2003. Identification of operator sites of the CI repressor of the phage TP901-1: evolutionary link to the other phages. Virology 311, 144-156. <P>cI sequence slightly different from part C0051. NCBI locus: NC_001416 true crackdots annotation2214007 1 Help:Barcodes range2214007 1 580 604 annotation306574 1 LVA range306574 1 541 573 annotation302645 1 cI tp901 range302645 1 1 540 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0075_sequence 1 atgaaaaccgataccagtaacagattaaaacaaataatggcggaacgcaacctgaaacaggtggatatcttaaacttatcgattccatttcagaaaaaatttggtatcaagctgagtaaaagtacgctgtcgcagtatgtgaactctgtgcagtcgccagaccagaaccgcatctatttactggcgaaaacgctgggcgtttccgaagcttggctgatgggatttgatgttccaatggttgaatcgtcgaaaatcgaaaacgattcggaaaacatcgaagaaaccattacggtgatgaaaaaattggaagagccgagacagaaagtggtcctggataccgccaaaattcagctgaaagaacaggatgagcagaacaaagtgaaacagatcgaagattaccgtctaagtgatgaatatttagaagaacagatcagtaaagcgagtgcatatggaggtggccaattaaatgacaacgataaagaatttttcaaacgtttgttgaaaaacacgttaaaagaaaaaattgataaaggagatctggctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_I9006_sequence 1 aaagaggagaaatactagatgaaaaccgataccagtaacagattaaaacaaataatggcggaacgcaacctgaaacaggtggatatcttaaacttatcgattccatttcagaaaaaatttggtatcaagctgagtaaaagtacgctgtcgcagtatgtgaactctgtgcagtcgccagaccagaaccgcatctatttactggcgaaaacgctgggcgtttccgaagcttggctgatgggatttgatgttccaatggttgaatcgtcgaaaatcgaaaacgattcggaaaacatcgaagaaaccattacggtgatgaaaaaattggaagagccgagacagaaagtggtcctggataccgccaaaattcagctgaaagaacaggatgagcagaacaaagtgaaacagatcgaagattaccgtctaagtgatgaatatttagaagaacagatcagtaaagcgagtgcatatggaggtggccaattaaatgacaacgataaagaatttttcaaacgtttgttgaaaaacacgttaaaagaaaaaattgataaaggagatctggctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z