BBa_J01002 1 OriTF OriT-F (Origin of Transfer for the F-plasmid nic region) 2005-10-17T11:00:00Z 2015-08-31T04:08:11Z OriTf (Origin of Transfer for the F-type conjugative plasmid) is the nic region, is where the relaxosome nicks the plasmid and conjugative transfer by F plasmid machinery begins via rolling circle replication. <br> This particular plasmid has been derived from a F-type plasmid donated by Professor Laura Frost University of Alberta. <br> <small> NOTE: OriTf is NOT the same as the host cell's native Origin of Transfer (this is a separate site within the bacterial host's main genome). <br> </small> false false _13_ 0 395 13 It's complicated false true Golden Bear BBa_J01002_sequence 1 aaggctcaacaggttggtggttctcaccaccaaaagcaccacaccccacgcaaaaacaagtttttgctgatttttctttataaatagagtgttatgaaaaattagtttctcttactctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaacgcgccgacaccgttttgtaggggtggtactgactatttttataaaaaacattattttatattaggggtgctgctagcggcgcggtgtgtttttttataggataccgctaggggcgctgctagcggtgcgtccctgtttgcattatgaattttagtgtttcgaaattaactttattttatgttcaaaaaaggtaatctctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z