BBa_J01006 1 KP3 Key Promoter absorbs 3 2005-10-31T12:00:00Z 2015-08-31T04:08:11Z Promoter for transcribing keys to act on locks based on Isaacs, Collins, et. al: <a href="http://www.nature.com/nbt/journal/v22/n7/full/nbt986.html;jsessionid=464FF968289CFEAE2031D9BC81CDF6EC"> "Engineered riboregulators enable post-transcriptional control of gene expression"</a> KP3 absorbs three nucleotides from mixed site ("TACTAGAG"), so that the key has a 5 nucleotide spacer region (i.e. "TAGAG") between the transcription start site and the first nucleotide of the key. We are still looking into what the optimal size for the spacer region is. See also KP2 (BBa_J01007), and Key1 (BBa_J01008), Key2 (BBa_J01009), Lock1 (BBa_J01010), and Lock2 (BBa_J01011). false false _13_ 0 395 13 Not in stock false false Golden Bear BBa_J01006_sequence 1 tcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z