BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J01021 1 StrRBS.Tra [StrRBS][TraJR] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z [StrRBS][TraJR] false false _13_ 0 395 13 Not in stock false false Golden Bear component2218195 1 BBa_J01001 component2218193 1 BBa_B0034 annotation2218193 1 BBa_B0034 range2218193 1 1 12 annotation2218195 1 BBa_J01001 range2218195 1 19 396 BBa_I12007 1 Prm + Modified lambda Prm promoter (OR-3 obliterated) 2004-07-14T11:00:00Z 2015-08-31T04:07:31Z Shih and Gussin (1983) Released HQ 2013 Lambda Prm promoter modified to be activated but not repressed by the lambda repressor (cI) false true _3_ 0 103 7 In stock false In wild type lambda phage, the OR3 site (-27 to -11) reads "tatcccttgcggtgata" on the sense strand of DNA. To prevent lambda repressor (cI) from binding to this site, the 4th through 10th nt of OR3 were replaced by the 7 nt between OR2 and OR1, "aaatagt" (-57 to -51), which in effect mutates 5 nt of the promoter. These nt were chosen to be about halfway between the -10 and -35 boxes of the promoter. Furthermore, since these nt already act as a spacer in wild-type phage, it is hoped they will not create undesired interactions. true Hans annotation937701 1 OR1 range937701 1 9 25 annotation937704 1 mutate to obliterate OR3 range937704 1 59 65 annotation937703 1 -35 range937703 1 48 53 annotation937702 1 OR2 range937702 1 33 49 annotation937705 1 -10 range937705 1 71 76 BBa_J01001 1 TraJR TraJr protein (controls conjugative transfer in RP4 plasmid) 2005-10-17T11:00:00Z 2015-08-31T04:08:11Z TraJR controls conjugative transfer in R plasmid false false _13_ 0 395 13 It's complicated false true Berkeley iGEM 2005 annotation1891611 1 TraJr range1891611 1 1 378 BBa_J01023 1 BBa_J01023 [pRM TraJR] = [pRM][StrRBS][TraJR] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z [pRM][StrRBS][TraJR] also internally referred to as i12341 false false _13_ 0 395 13 Not in stock false false Golden Bear component2219278 1 BBa_I12007 component2219283 1 BBa_J01021 annotation2219283 1 BBa_J01021 range2219283 1 91 486 annotation2219278 1 BBa_I12007 range2219278 1 1 82 BBa_J01023_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgttactagagaaagaggagaaatactagatggctgatgaaaccaagccaaccaggaagggcagcccacctatcaaggtgtactgccttccagacgaacgaagagcgattgaggaaaaggcggcggcggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgataataa BBa_I12007_sequence 1 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt BBa_B0034_sequence 1 aaagaggagaaa BBa_J01021_sequence 1 aaagaggagaaatactagatggctgatgaaaccaagccaaccaggaagggcagcccacctatcaaggtgtactgccttccagacgaacgaagagcgattgaggaaaaggcggcggcggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgataataa BBa_J01001_sequence 1 atggctgatgaaaccaagccaaccaggaagggcagcccacctatcaaggtgtactgccttccagacgaacgaagagcgattgaggaaaaggcggcggcggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z