BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J01028 1 BBa_J01028 [spo0A][DblTerminator] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z [spo0A][DblTerminator] false false _13_ 0 395 13 Not in stock false false Golden Bear component1775387 1 BBa_B0010 component1775397 1 BBa_B0012 component1775382 1 BBa_J01004 annotation1775382 1 BBa_J01004 range1775382 1 1 381 annotation1775387 1 BBa_B0010 range1775387 1 390 469 annotation1775397 1 BBa_B0012 range1775397 1 478 518 BBa_J01004 1 Spo0A Spo0A Transcription Factor 2005-10-28T11:00:00Z 2015-08-31T04:08:11Z Spo0A transcription factor that is active in the sporulation pathway in b. subtilis. Activates the pspoIIe (BBa_J01005) promoter. false false _13_ 0 395 13 Not in stock false false Golden Bear BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J01004_sequence 1 atgagcagccagcctgaaccaaagaagaaaaatctcgacgcgagcatcacaagcattatccatgaaatcggcgtcccagcccatattaaaggctatctctatctgcgcgaagcaatctcaatggtatacaatgacatcgaattgctcggcagcattacaaaagtcctctatccggacatcgccaaaaaatttaacacaaccgcaagccgtgtagaaagagcgatccgccatgcaattgaagtggcatggagcagaggaaacattgattccatttcctcgttgtttggttatactgtcagcatgacaaaagctaaacctaccaacagtgaatttattgcaatggttgcggataagctgaggttagagcataaggcttcttaa BBa_J01028_sequence 1 atgagcagccagcctgaaccaaagaagaaaaatctcgacgcgagcatcacaagcattatccatgaaatcggcgtcccagcccatattaaaggctatctctatctgcgcgaagcaatctcaatggtatacaatgacatcgaattgctcggcagcattacaaaagtcctctatccggacatcgccaaaaaatttaacacaaccgcaagccgtgtagaaagagcgatccgccatgcaattgaagtggcatggagcagaggaaacattgattccatttcctcgttgtttggttatactgtcagcatgacaaaagctaaacctaccaacagtgaatttattgcaatggttgcggataagctgaggttagagcataaggcttcttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z