BBa_J01030 1 BBa_J01030 OnLock2 = [pTet][Lock2] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z [pTet][Lock2] true false _13_ 0 395 13 Discontinued false false Golden Bear component1739133 1 BBa_R0040 component1739138 1 BBa_J01011 annotation1739133 1 BBa_R0040 range1739133 1 1 54 annotation1739138 1 BBa_J01011 range1739138 1 63 102 BBa_J01011 1 Lock 2 Riboregulator Lock 2 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Variant of biobricked version of Isaacs' riboregulator cis repressed lock, crR12, only change is in the address region. true false _13_ 0 395 13 Discontinued false false Golden Bear BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 BBa_J01030_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaactagaatcacctctagtgattgggttcaatagaggaga BBa_J01011_sequence 1 aactagaatcacctctagtgattgggttcaatagaggaga BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z