BBa_J01009 1 Key 2 Riboregulator Key 2 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Another variant of biobricked version of Isaacs' riboregulator trans activating key, taR12, only change is in the address region. true false _13_ 0 395 13 Discontinued false false Golden Bear BBa_J01055 1 KP3.Key2 OnKey2 = [Key promoter KP3][Key 2] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Key 2 under the key promoter. false false _13_ 0 395 13 Not in stock false false Golden Bear component2218197 1 BBa_J01009 component2218196 1 BBa_J01006 annotation2218197 1 BBa_J01009 range2218197 1 68 161 annotation2218196 1 BBa_J01006 range2218196 1 1 59 BBa_J01006 1 KP3 Key Promoter absorbs 3 2005-10-31T12:00:00Z 2015-08-31T04:08:11Z Promoter for transcribing keys to act on locks based on Isaacs, Collins, et. al: <a href="http://www.nature.com/nbt/journal/v22/n7/full/nbt986.html;jsessionid=464FF968289CFEAE2031D9BC81CDF6EC"> "Engineered riboregulators enable post-transcriptional control of gene expression"</a> KP3 absorbs three nucleotides from mixed site ("TACTAGAG"), so that the key has a 5 nucleotide spacer region (i.e. "TAGAG") between the transcription start site and the first nucleotide of the key. We are still looking into what the optimal size for the spacer region is. See also KP2 (BBa_J01007), and Key1 (BBa_J01008), Key2 (BBa_J01009), Lock1 (BBa_J01010), and Lock2 (BBa_J01011). false false _13_ 0 395 13 Not in stock false false Golden Bear BBa_J01006_sequence 1 tcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgcca BBa_J01055_sequence 1 tcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgccatactagagacccaatcactggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctcttgaaagccagattattaatccggctt BBa_J01009_sequence 1 acccaatcactggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctcttgaaagccagattattaatccggctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z