BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J01058 1 BBa_J01058 [cI][DblTerminator] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z [cI][DblTerminator] false false _13_ 0 395 13 It's complicated false false Golden Bear component1738415 1 BBa_B0010 component1738425 1 BBa_B0012 component1738408 1 BBa_C0051 annotation1738408 1 BBa_C0051 range1738408 1 1 750 annotation1738425 1 BBa_B0012 range1738425 1 872 912 annotation1738415 1 BBa_B0010 range1738415 1 784 863 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation23334 1 cI lambda range23334 1 4 711 annotation23335 1 LVA range23335 1 712 744 annotation2213991 1 Help:Barcodes range2213991 1 751 775 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_J01058_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z