BBa_J01021 1 StrRBS.Tra [StrRBS][TraJR] 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z [StrRBS][TraJR] false false _13_ 0 395 13 Not in stock false false Golden Bear component2218195 1 BBa_J01001 component2218193 1 BBa_B0034 annotation2218193 1 BBa_B0034 range2218193 1 1 12 annotation2218195 1 BBa_J01001 range2218195 1 19 396 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2023 1 -35 range2023 1 15 20 annotation2022 1 -10 range2022 1 38 43 annotation2024 1 OR1 range2024 1 25 41 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2025 1 OR2 range2025 1 1 17 BBa_J01103 1 BBa_J01103 TEST [pcI Lam][StrRBS][TraJR] 2005-12-29T12:00:00Z 2015-08-31T04:08:13Z TEST [pLam][StrRBS][TraJR] false false _13_ 0 395 13 Not in stock false false Golden Bear component2219285 1 BBa_R0051 component2219293 1 BBa_J01021 annotation2219285 1 BBa_R0051 range2219285 1 1 49 annotation2219293 1 BBa_J01021 range2219293 1 58 453 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J01001 1 TraJR TraJr protein (controls conjugative transfer in RP4 plasmid) 2005-10-17T11:00:00Z 2015-08-31T04:08:11Z TraJR controls conjugative transfer in R plasmid false false _13_ 0 395 13 It's complicated false true Berkeley iGEM 2005 annotation1891611 1 TraJr range1891611 1 1 378 BBa_J01103_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagatggctgatgaaaccaagccaaccaggaagggcagcccacctatcaaggtgtactgccttccagacgaacgaagagcgattgaggaaaaggcggcggcggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgataataa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_J01021_sequence 1 aaagaggagaaatactagatggctgatgaaaccaagccaaccaggaagggcagcccacctatcaaggtgtactgccttccagacgaacgaagagcgattgaggaaaaggcggcggcggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgataataa BBa_J01001_sequence 1 atggctgatgaaaccaagccaaccaggaagggcagcccacctatcaaggtgtactgccttccagacgaacgaagagcgattgaggaaaaggcggcggcggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z