BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2000 1 -35 range2000 1 20 25 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 BBa_J01008 1 Key 1 Riboregulator key 1 2005-11-05T12:00:00Z 2015-08-31T04:08:12Z Released HQ 2013 Biobricked version of Isaacs' riboregulator trans activating key, taR12 false true _13_ 0 395 13 In stock false false Golden Bear BBa_J01141 1 BBa_J01141 [pLacI pL][key1] 2006-04-13T11:00:00Z 2015-08-31T04:08:13Z Released HQ 2013 -- No description -- false false _13_1_ 0 612 13 In stock false false Golden Bear (Berkeley iGEM 2005) component1843682 1 BBa_R0011 component1843688 1 BBa_J01008 annotation1843682 1 BBa_R0011 range1843682 1 1 54 annotation1843688 1 BBa_J01008 range1843688 1 64 157 BBa_J01141_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagacccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_J01008_sequence 1 acccaaatccaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z