BBa_J03210 1 BBa_J03210 malE [Maltose-binding Protein] 2006-08-07T11:00:00Z 2015-08-31T04:08:13Z Swedish Centre for Bioprocess technology, Stockholm Ref: Larson, G.(2004) "Solubility and proteolysis of the Zb-malE and Zb-malE31 proteins during overproduction in Escherichia coli." Biotechnology & Bioengineering Volume 90, Issue 2, Pages 239-247 malE encodes the Maltose-binding Protein, essential for both transport and chemotaxis. It resides in the periplasm. false false _15_ 0 740 15 Not in stock true The sequence information was acquired from Genbank and the physical DNA shipped from the Larson Lab, Stockholm. PCR was used to produce BioBrick false James Brown annotation1894080 1 MBP range1894080 1 1 341 annotation1894079 1 Start codon range1894079 1 1 3 BBa_J03210_sequence 1 atgaaaataaaaacaggtgcacgcatcctcgcattatccgcattaacgacgatgatgttttccgcctcggctctcgccaaaatcgaagaaggtaaactggtaatctggattaacggcgataaaggctataacggtctcgctgaagtcggtaagaaattcgagaaagataccggaattaaagtcaccgttgagcatccggataaactggaagagaaattcccacaggttgcggcaactggcgatggccctgacattatcttctgggcacacgaccgctttggtggctacgctcaatctggcctgttggctgaaatcaccccggacaaagcgttccaggacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z