BBa_J04605 1 BBa_J04605 R0010 with Anti-Sense Theophillline Induced Antiswitch ("On Switch") 2005-09-14T11:00:00Z 2015-08-31T04:08:14Z This part contains the R0010 Promoter region attached to an anti-sense antiswitch sequence for the regulation of EYFP This Promoter and Antiswitch construct is designed so that it can be attached to any form of the EYFP coding region. The purpose of this piece is to regulate the expression of YFP in the presence of theophylline. In this construct, the presence of theophylline causes the antiswitch, which is initially bound to the YFP coding region (preventing expression), to release and fold up on itself allowing for EYFP expression. false false _16_ 0 435 16 Not in stock false Adaptation of antiswitch design "S8" by Bayer and Smolke; article available at http://www.nature.com/nbt/journal/v23/n3/full/nbt1069.html false Oscar Hernandez and Matt Gemberling annotation1691971 1 Hammerhead Riobozyme #2 range1691971 1 309 359 annotation1691967 1 Antiswitch range1691967 1 254 308 annotation1691966 1 Hammerhead Riobozyme #1 range1691966 1 201 253 annotation1691995 1 Antisense Binding Sequence range1691995 1 254 268 annotation1691965 1 R0010 Promoter Region range1691965 1 1 200 BBa_J04605_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggatcccaagctgatgagtccgtgaggacgaaacggtaggacttcctaccgtccttgctcaccatctagtaccagcatcgtcttgatgcccttggcagctagatggtaccggagtcgactccggtctgatgagtccgtgaggacgaaaccatctcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z