BBa_J04606 1 BBa_J04606 Antiswitch repressing Biobrick coding sequence at the RBS ("Off" switch) 2005-06-27T11:00:00Z 2015-08-31T04:08:14Z Adaptation of antiswitch design "S1" by Bayer and Smolke; article available at http://www.nature.com/nbt/journal/v23/n3/full/nbt1069.html The presence of theophylline prevents translation of mRNA coding region directly downstream from any Biobrick that contains the BBa_B0034 RBS. This effect is the result of the antiswitch attaching to the B0034 RBS preceding the coding region. The absence of theophylline allows expression of the coding region as usual. false false _16_ 0 331 16 It's complicated false Transcription of the antiswitch is repressed in the presence of tetR. Also, the actual RBS sequence of BBa_B0034 is only 12 bp long; three additional base pairs comprise the total target sequence, and these additional 3 bp's correspond to the last three base pairs of the B0034 Biobrick Prefix, Xba I. false Nicholas Cain, Davidson College annotation1553376 1 Hammerhead Riobozyme #1 range1553376 1 55 107 annotation1553380 1 Antiswitch range1553380 1 108 181 annotation1553357 1 R0010 Promoter Region range1553357 1 1 54 annotation1553383 1 Hammerhead Riobozyme #2 range1553383 1 182 232 annotation1553384 1 B0015 Terminator range1553384 1 233 360 annotation1553382 1 Antisense Binding Sequence range1553382 1 108 122 BBa_J04606_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacggatccgaaactgatgagtccgtgaggacgaaacggtaggaattcctaccgtctttctcctctttctccctcgagaaagaggagaaagataccagcatcgtcttgatgcccttggcagctttctcctaccggagtcgactccggtctgatgagtccgtgaggacgaaaggagctcgagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z