BBa_J04685 1 BBa_J04685 Antiswitch enabling production of EYFP ("On" switch) 2005-06-27T11:00:00Z 2015-08-31T04:08:15Z Adaptation of antiswitch design "S8" by Bayer and Smolke; article available at http://www.nature.com/nbt/journal/v23/n3/full/nbt1069.html The presence of theophylline allows translation of mRNA transcribed from Biobrick BBa_E0032. No theophylline present causes repression of the coding region of BBa_E0032. false false _16_ 0 331 16 It's complicated false Transcription of the antiswitch is repressed in the presence of tetR. false Nicholas Cain, Davidson College annotation1553270 1 R0010 Promoter Region range1553270 1 1 54 annotation1553271 1 Hammerhead Riobozyme #1 range1553271 1 55 107 annotation1553290 1 B0015 Terminator range1553290 1 214 341 annotation1553286 1 Hammerhead Riobozyme #2 range1553286 1 163 213 annotation1553282 1 Antisense Binding Sequence range1553282 1 108 122 annotation1553272 1 Antiswitch range1553272 1 108 162 BBa_J04685_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacggatcccaagctgatgagtccgtgaggacgaaacggtaggaattcctaccgtccttgctcaccatctagataccagcatcgtcttgatgcccttggcagctagatggtaccggagtcgactccggtctgatgagtccgtgaggacgaaaccatctcgagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z