BBa_J04686 1 BBa_J04686 Antiswitch repressing production of EYFP ("Off" switch) 2005-06-27T11:00:00Z 2015-08-31T04:08:15Z Adaptation of antiswitch design "S1" by Bayer and Smolke; article available at http://www.nature.com/nbt/journal/v23/n3/full/nbt1069.html The presence of theophylline prevents translation of mRNA transcribed from Biobrick BBa_E0032. The absence of theophylline allows expression of the coding region of BBa_E0032. false false _16_ 0 331 16 It's complicated false Transcription of the antiswitch is repressed in the presence of tetR false Nicholas Cain, Davidson College annotation1553215 1 B0015 Terminator range1553215 1 233 360 annotation1553213 1 "On" Antiswitch range1553213 1 108 181 annotation1553095 1 Hammerhead Riobozyme #1 range1553095 1 55 107 annotation1553216 1 Antisense Binding Sequence range1553216 1 108 122 annotation1553214 1 Hammerhead Riobozyme #2 range1553214 1 182 232 annotation1553090 1 R0010 Promoter Region range1553090 1 1 54 BBa_J04686_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacggatcccaagctgatgagtccgtgaggacgaaacggtaggaattcctaccgtccttgctcaccatctacctctagatggtgagcaaggataccagcatcgtcttgatgcccttggcagccttgctcaaccggagtcgactccggtctgatgagtccgtgaggacgaaagagcctcgagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z