BBa_J04700 1 Riboswitch Part containing promoter, riboswitch mTCT8-4 theophylline aptamer (J04705), and RBS 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z The specific parts contained within this part are (R0010. J04705. 8 bp. B0034). The riboswitch J04705 is designed to make or break a "kink" in the mRNA when theophylline is present. The ribosome should be obstructed in cases where there is a "kink" in the stem loop. When this happens translation should be turned off. We have ligated this part with yellow fluorescent protein (YFP) and a terminator and will test soon to determine whether the aptamer has a regulatory function on the production of YFP. The J04705 aptamer was taken from {R. Jenison, S. Gill, A. Pardi, B. Polisky, Science 263, 1426 (1994).} The 8 bp sequence was gotten from Gallivan and Desai supplemental material I believe. Gallivan and Desai used this same aptamer J04705, but added many extra bases. We are testing whether those bases are really necessary or whether one can just use the aptamer to regulate translation. false false _16_ 0 326 16 Not in stock false false Kristen DeCelle annotation1730477 1 Promoter (R0010) range1730477 1 1 200 annotation1730480 1 RBS (B0034) range1730480 1 247 258 annotation1730478 1 Aptamer (J04705) range1730478 1 201 238 annotation1730479 1 8 bp from Gallivan paper range1730479 1 239 246 BBa_J04700_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggtgataccagcatcgtcttgatgcccttggcagcacctataaaagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z