BBa_J04705 1 mTCT8-4 Riboswitch designed to turn "ON" a protein 2005-09-10T11:00:00Z 2015-08-31T04:08:15Z The riboswitch is designed to be linked to an RBS using a 5-8 bp sequence. Once transcribed into RNA, the riboswitch will hopefully turn on whatever protein we want it to. At this point, we hope to turn on mCherry. false true _16_ 0 326 16 Not in stock false false Kristen DeCelle BBa_J04705_sequence 1 ggtgataccagcatcgtcttgatgcccttggcagcacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z