BBa_J04800 1 Riboswitch J04800 (RevAptRibo) contains a theophylline aptamer upstream of the RBS that should act as a riboswi 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z Like J04700 and J04900, J04800 contains a promoter, a theophylline aptamer, an 8bp sequence and an RBS, in that order. On either end, J04800 uses strandard Biobrick ends. The aptamer sequence comes from {R. Jenison, S. Gill, A. Pardi, B. Polisky, Science 263, 1426 (1994)}. However, the aptamer sequence is in reverse nucleotide order, hence the name, ReverseAptamerRiboswitch (RevAptRibo). The aptamer portion of the mRNA transcript should alter shape when it binds theophylline. This change in shape may affect expression levels, which would make this a synthetic, theophylline-dependent riboswitch. The Biobrick ends allow for convenient ligation of the riboswitch to a gene of choice. false false _16_ 0 436 16 Not in stock false false Andrew Drysdale annotation1691996 1 B0034 range1691996 1 247 258 annotation1691994 1 theophylline apatmer range1691994 1 201 238 annotation1734221 1 8bp range1734221 1 239 246 annotation1691993 1 R0010 range1691993 1 1 200 BBa_J04800_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaccacgacggttcccgtagttctgctacgaccatagtggtataaaagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z