BBa_E0032 1 YFP enhanced yellow fluorescent protein derived from A. victoria GFP 2003-01-31T12:00:00Z 2015-08-31T04:07:25Z Modified from <bb_part>BBa_E0031</bb_part> Released HQ 2013 Yellow fluorescent protein (EYFP) reporter coding sequence without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. </P> Annotated mutation cause a Q81L mutation that appears to not be near the active site. </P> false false _1_ 0 24 7 In stock false <P> <P>BBa_E0032 yellow fluorescent protein is based on BioBrick part BBa_E0031. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation2159 1 2 range2159 1 757 762 annotation2160 1 SsrA range2160 1 718 756 annotation2161 1 A (Q->L) range2161 1 242 242 annotation2156 1 YFP (LVA) range2156 1 1 762 annotation7041 1 BBa_E0032 range7041 1 1 762 BBa_J04800 1 Riboswitch J04800 (RevAptRibo) contains a theophylline aptamer upstream of the RBS that should act as a riboswi 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z Like J04700 and J04900, J04800 contains a promoter, a theophylline aptamer, an 8bp sequence and an RBS, in that order. On either end, J04800 uses strandard Biobrick ends. The aptamer sequence comes from {R. Jenison, S. Gill, A. Pardi, B. Polisky, Science 263, 1426 (1994)}. However, the aptamer sequence is in reverse nucleotide order, hence the name, ReverseAptamerRiboswitch (RevAptRibo). The aptamer portion of the mRNA transcript should alter shape when it binds theophylline. This change in shape may affect expression levels, which would make this a synthetic, theophylline-dependent riboswitch. The Biobrick ends allow for convenient ligation of the riboswitch to a gene of choice. false false _16_ 0 436 16 Not in stock false false Andrew Drysdale annotation1691996 1 B0034 range1691996 1 247 258 annotation1734221 1 8bp range1734221 1 239 246 annotation1691993 1 R0010 range1691993 1 1 200 annotation1691994 1 theophylline apatmer range1691994 1 201 238 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_J04871 1 BBa_J04871 BBa_J04800 (RevAptRibo) Riboswitch with BBa_J04671 (EYFP, RBS-, LVA+, B0015) 2005-11-02T12:00:00Z 2015-08-31T04:08:15Z Released HQ 2013 This is a (RevAptRibo) Riboswitch device that contains a EYFP reporter region with an LVA tag and a B0015 Terminator Sequence false false _16_ 0 435 16 In stock false false Andrew Drysdale and Kristen DeCelle (also Oscar Hernandez and Matt Gemberling) component1735053 1 BBa_E0032 component1735071 1 BBa_B0012 component1735061 1 BBa_B0010 component1735041 1 BBa_J04800 annotation1735071 1 BBa_B0012 range1735071 1 1123 1163 annotation1735041 1 BBa_J04800 range1735041 1 1 258 annotation1735061 1 BBa_B0010 range1735061 1 1035 1114 annotation1735053 1 BBa_E0032 range1735053 1 265 1026 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J04871_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaccacgacggttcccgtagttctgctacgaccatagtggtataaaagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0032_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaggcctgctgcaaacgacgaaaactacgctttagtagcttaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J04800_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaccacgacggttcccgtagttctgctacgaccatagtggtataaaagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z