BBa_J04900 1 Riboswitch Part containing promoter, 8 bp, RBS, and riboswitch mTCT8-4 theophylline aptamer (J04705) 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z The specific parts contained within this part are (R0010. 8 bp. B0034. J04705). The riboswitch J04705 is designed to make or break a "kink" in the mRNA when theophylline is present. The ribosome should be obstructed in cases where there is a "kink" in the stem loop. When this happens translation should be turned off. We have ligated this part with yellow fluorescent protein (YFP) and a terminator and will test soon to determine whether the aptamer has a regulatory function on the production of YFP. The J04705 aptamer was taken from {R. Jenison, S. Gill, A. Pardi, B. Polisky, Science 263, 1426 (1994).} The 8 bp sequence was gotten from Gallivan and Desai supplemental material I believe. Gallivan and Desai used this same aptamer J04705, but added many extra bases. We are testing whether those bases are really necessary or whether one can just use the aptamer to regulate translation. The results from testing J04900 will hopefully tell us whether one can put the aptamer between the RBS and the coding region or whether translation is inhibited as we have heard. false false _16_ 0 326 16 Not in stock false false Kristen DeCelle annotation1730506 1 8 bp from Gallivan paper? range1730506 1 201 208 annotation1730507 1 RBS (B0034) range1730507 1 209 220 annotation1730508 1 Aptamer (J04705) range1730508 1 221 258 annotation1730505 1 R0010 range1730505 1 1 200 BBa_J04900_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatataaaagaaagaggagaaaggtgataccagcatcgtcttgatgcccttggcagcacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z