BBa_J05221 1 BBa_J05221 Tripple Binding Site for R3-ATF6 2005-09-07T11:00:00Z 2015-08-31T04:08:15Z Three binding sites for R3-ATF6 in a row with a 3 bp spacers. false false _34_ 0 412 34 Not in stock false false Alexander Roth BBa_J05221_sequence 1 cctcgcccccgggggcgagggcctcgcccccgggggcgagggcctcgcccccgggggcgagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z