BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J05301 1 BBa_J05301 R1 system A 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z Part R1 for the counter true false _34_ 0 412 34 Discontinued false false Alexander Roth component1690133 1 BBa_B0034 component1690153 1 BBa_B0012 component1690128 1 BBa_J05211 component1690137 1 BBa_J05100 component1690143 1 BBa_B0010 annotation1690133 1 BBa_B0034 range1690133 1 33 44 annotation1690128 1 BBa_J05211 range1690128 1 1 24 annotation1690153 1 BBa_B0012 range1690153 1 481 521 annotation1690143 1 BBa_B0010 range1690143 1 393 472 annotation1690137 1 BBa_J05100 range1690137 1 51 359 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_J05100 1 BBa_J05100 Repressor R1-b3 2005-09-03T11:00:00Z 2015-08-31T04:08:15Z R1-b3 (GGA GGG GAC) true false _34_ 0 412 34 Discontinued false false Alexander Roth BBa_J05211 1 BBa_J05211 Regulator for R1-b3 2005-09-05T11:00:00Z 2015-08-31T04:08:15Z binding sites for R3 and R2 true false _34_ 0 412 34 Discontinued false false Alexander Roth BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J05211_sequence 1 ggaggcggggcgcggggggcgagg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05301_sequence 1 ggaggcggggcgcggggggcgaggtactagagaaagaggagaaatactagatggcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagctttagcgatccgggcaacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggctaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05100_sequence 1 atggcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagctttagcgatccgggcaacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z