BBa_J05101 1 BBa_J05101 Repressor R3-e2 2005-09-03T11:00:00Z 2015-08-31T04:08:15Z R3-e2 (GGG GGC GAG) false false _34_ 0 412 34 Not in stock false false Alexander Roth annotation1729375 1 Finger 1 range1729375 1 34 117 annotation1729378 1 ZF-GAG range1729378 1 67 90 annotation2214040 1 Help:Barcodes range2214040 1 310 334 annotation1729376 1 Finger 2 range1729376 1 118 201 annotation1729380 1 ZF-GGG range1729380 1 235 258 annotation1729377 1 Finger 3 range1729377 1 202 285 annotation1729379 1 ZF-GGC range1729379 1 151 174 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J05213 1 BBa_J05213 Regulator for R3-e2 2005-09-05T11:00:00Z 2015-08-31T04:08:15Z binding sites for R1 and R4 true false _34_ 0 412 34 Discontinued false false Alexander Roth BBa_J05303 1 BBa_J05303 R3 system A 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z true false _34_ 0 412 34 Discontinued false false Alexander Roth component1690276 1 BBa_B0034 component1690271 1 BBa_J05213 component1690296 1 BBa_B0012 component1690286 1 BBa_B0010 component1690280 1 BBa_J05101 annotation1690296 1 BBa_B0012 range1690296 1 481 521 annotation1690276 1 BBa_B0034 range1690276 1 33 44 annotation1690280 1 BBa_J05101 range1690280 1 51 359 annotation1690271 1 BBa_J05213 range1690271 1 1 24 annotation1690286 1 BBa_B0010 range1690286 1 393 472 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J05101_sequence 1 atggcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagctttagccgcagcgataacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggctaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J05303_sequence 1 ggaggggacgcgcgggggccggagtactagagaaagaggagaaatactagatggcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagctttagccgcagcgataacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggctaataactctgatagtgctagtgtagatctctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05213_sequence 1 ggaggggacgcgcgggggccggag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z