BBa_J05101 1 BBa_J05101 Repressor R3-e2 2005-09-03T11:00:00Z 2015-08-31T04:08:15Z R3-e2 (GGG GGC GAG) false false _34_ 0 412 34 Not in stock false false Alexander Roth annotation1729375 1 Finger 1 range1729375 1 34 117 annotation1729378 1 ZF-GAG range1729378 1 67 90 annotation1729376 1 Finger 2 range1729376 1 118 201 annotation2214040 1 Help:Barcodes range2214040 1 310 334 annotation1729379 1 ZF-GGC range1729379 1 151 174 annotation1729380 1 ZF-GGG range1729380 1 235 258 annotation1729377 1 Finger 3 range1729377 1 202 285 BBa_J05305 1 BBa_J05305 R3 sys A -Terminator 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z R3 protein -Terminator (to be fused to e.g. reporter) true false _34_ 0 412 34 Discontinued false false Alexander Roth component1695348 1 BBa_J05213 component1695357 1 BBa_J05101 component1695353 1 BBa_B0034 annotation1695353 1 BBa_B0034 range1695353 1 33 44 annotation1695357 1 BBa_J05101 range1695357 1 51 359 annotation1695348 1 BBa_J05213 range1695348 1 1 24 BBa_J05213 1 BBa_J05213 Regulator for R3-e2 2005-09-05T11:00:00Z 2015-08-31T04:08:15Z binding sites for R1 and R4 true false _34_ 0 412 34 Discontinued false false Alexander Roth BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J05101_sequence 1 atggcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagctttagccgcagcgataacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggctaataactctgatagtgctagtgtagatctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J05305_sequence 1 ggaggggacgcgcgggggccggagtactagagaaagaggagaaatactagatggcgcaggcggcgctggaaccgaaagaaaaaccgtatgcgtgcccggaatgcggcaaaagctttagccgcagcgataacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggccatctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcaaaaaaaccagcggccaggcgggctaataactctgatagtgctagtgtagatctc BBa_J05213_sequence 1 ggaggggacgcgcgggggccggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z