BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J05215 1 BBa_J05215 Regulator for R1-CREBH 2005-09-07T11:00:00Z 2015-08-31T04:08:15Z binding sites for R3-ATF6 and R2-YAP7 false false _34_ 0 412 34 Not in stock false false Alexander Roth BBa_J05311 1 BBa_J05311 R1 state 2005-09-14T11:00:00Z 2015-08-31T04:08:15Z false false _34_ 0 412 34 Not in stock false false Alexander Roth component2221731 1 BBa_B0034 component2221739 1 BBa_J05108 component2221746 1 BBa_B0015 component2221729 1 BBa_J05215 annotation2221746 1 BBa_B0015 range2221746 1 536 664 annotation2221729 1 BBa_J05215 range2221729 1 1 41 annotation2221731 1 BBa_B0034 range2221731 1 50 61 annotation2221739 1 BBa_J05108 range2221739 1 68 527 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_J05108 1 R1 Repressor R1-CREBH 2005-09-03T11:00:00Z 2015-08-31T04:08:15Z HR1-CREBH (GGA GGG GAC) => (GTC CCC TCC GGA GGG GAC) false false _34_ 0 412 34 Not in stock false false Alexander Roth annotation1730072 1 Finger 3 range1730072 1 190 273 annotation2214041 1 Help:Barcodes range2214041 1 436 460 annotation1730073 1 ZF-GGA range1730073 1 223 246 annotation1730071 1 ZF-GGG range1730071 1 139 162 annotation1730069 1 ZF-GAC range1730069 1 55 78 annotation1730068 1 Finger 1 range1730068 1 22 105 annotation1730070 1 Finger 2 range1730070 1 106 189 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J05108_sequence 1 atgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggcaacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcaaaaaaaccagcgaatatattgatggcctggaaacccgcatgagcgcgtgcaccgcgcagaaccaggaactgcaacgcaaagtgctgcatctggaaaaacagaacctgagcctgctggaacagctgaaaaaactgcaagcgattgtggtgcagagcaccagctaataacgctgatagtgctagtgtagatcgc BBa_J05215_sequence 1 cctcgcccccgggggcgagggccccgcctccggaggcgggg BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J05311_sequence 1 cctcgcccccgggggcgagggccccgcctccggaggcggggtactagagaaagaggagaaatactagatgctggaaccgggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagcgatccgggcaacctggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccgcagcgataaactggtgcgccatcagcgcacccataccggcgaaaaaccgtataaatgcccggaatgcggcaaaagctttagccagcgcgcgcatctggaacgccatcagcgcacccataccggcaaaaaaaccagcgaatatattgatggcctggaaacccgcatgagcgcgtgcaccgcgcagaaccaggaactgcaacgcaaagtgctgcatctggaaaaacagaacctgagcctgctggaacagctgaaaaaactgcaagcgattgtggtgcagagcaccagctaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z